Classification of Human Transcription Factors
- Genera -
October 05, 2018
 
Display detail:  All levels |  Superclasses |  Classes |  Families |  Subfamilies |  Genera
 
1 Superclass: Basic domains TRANSFAC class description  
  1.1 Class: Basic leucine zipper factors (bZIP) TRANSFAC class description Further information  
  1.1.1 Family: Jun-related factors TGAGTCA  
  1.1.1.1 Subfamily: Jun factors TGAGTCA  
  1.1.1.1.1 c-Jun   UniProt  ProteinAtlas T00133 UniProt UniProt PDB
  1.1.1.1.2 JunB   UniProt  ProteinAtlas T01977 UniProt UniProt  
  1.1.1.1.3 JunD   UniProt  ProteinAtlas T01978 UniProt UniProt  
  1.1.1.2 Subfamily: NF-E2-like factors GCTGAGTCA  
  1.1.1.2.1 NF-E2 p45 UniProt  ProteinAtlas T09484 UniProt UniProt  
  1.1.1.2.2 NF-E2L1 (NRF1)   UniProt  ProteinAtlas T09066 UniProt UniProt  
  1.1.1.2.3 NF-E2L2 (NRF2)   UniProt  ProteinAtlas T01443 UniProt UniProt  
  1.1.1.2.4 NF-E2L3 (NRF3)   UniProt  ProteinAtlas T05709 UniProt UniProt  
  1.1.1.2.5 BACH1   UniProt  ProteinAtlas T09252 UniProt UniProt  
  1.1.1.2.6 BACH2   UniProt  ProteinAtlas T04795 UniProt UniProt  
  1.1.1.3 Subfamily: ATF-2-like factors TGACGTCA  
  1.1.1.3.1 ATF-2   UniProt  ProteinAtlas T10136 UniProt UniProt PDB
  1.1.1.3.2 ATF-7 UniProt  ProteinAtlas T18797 UniProt UniProt  
  1.1.1.3.3 CREB-5 (CRE-BPa) UniProt  ProteinAtlas T01308 UniProt UniProt  
  1.1.2 Family: Fos-related factors (TGAGTCA)  
  1.1.2.1 Subfamily: Fos factors (TGAGTCA)  
  1.1.2.1.1 c-Fos   UniProt  ProteinAtlas T00123 UniProt UniProt PDB
  1.1.2.1.2 FosB   UniProt  ProteinAtlas T08993 UniProt UniProt  
  1.1.2.1.3 Fra-1 (FosL1)   UniProt  ProteinAtlas T01462 UniProt UniProt  
  1.1.2.1.4 Fra-2 (FosL2)   UniProt  ProteinAtlas T01991 UniProt UniProt  
  1.1.2.2 Subfamily: ATF-3-like factors TGACGTCA  
  1.1.2.2.1 ATF-3   UniProt  ProteinAtlas T09553 UniProt UniProt  
  1.1.2.2.2 JDP-2 UniProt  ProteinAtlas T19032 UniProt UniProt  
  1.1.3 Family: Maf-related factors TGCTGACTCAGCA  
  1.1.3.1 Subfamily: Large Maf factors TGCTGACTCAGCA  
  1.1.3.1.1 c-Maf   UniProt  ProteinAtlas T05749 UniProt UniProt  
  1.1.3.1.2 MafA   UniProt  ProteinAtlas T08225 UniProt UniProt  
  1.1.3.1.3 MafB UniProt  ProteinAtlas T05748 UniProt UniProt PDB
  1.1.3.1.4 Nrl UniProt  ProteinAtlas T01082 UniProt UniProt  
  1.1.3.2 Subfamily: Small Maf factors TGCTGACTCAGCA  
  1.1.3.2.1 MafF UniProt  ProteinAtlas T05747 UniProt UniProt  
  1.1.3.2.2 MafG UniProt  ProteinAtlas T04870 UniProt UniProt  
  1.1.3.2.3 MafK UniProt  ProteinAtlas T04874 UniProt UniProt  
  1.1.4 Family: B-ATF-related factors TGAGTCA  
  1.1.4.0.1 B-ATF   UniProt  ProteinAtlas T18809 UniProt UniProt  
  1.1.4.0.2 B-ATF-2   UniProt  ProteinAtlas T22480 UniProt UniProt  
  1.1.4.0.3 B-ATF-3 UniProt  ProteinAtlas T18805 UniProt UniProt  
  1.1.5 Family: XBP-1-related factors GGATGACGTGTACA  
  1.1.5.0.1 XBP-1 UniProt  ProteinAtlas T00902 UniProt UniProt  
  1.1.6 Family: ATF-4-related factors TGACGTCA  
  1.1.6.0.1 ATF-4 UniProt  ProteinAtlas T01303 UniProt UniProt  
  1.1.6.0.2 ATF-5   UniProt  ProteinAtlas T04877 UniProt UniProt  
  1.1.7 Family: CREB-related factors TGACGTCA  
  1.1.7.1 Subfamily: CREB-like factors TGACGTCA  
  1.1.7.1.1 CREB (CREB1)   UniProt  ProteinAtlas T08562 UniProt UniProt PDB
  1.1.7.1.2 ATF-1   UniProt  ProteinAtlas T00968 UniProt UniProt  
  1.1.7.1.3 CREM   UniProt  ProteinAtlas T09585 UniProt UniProt  
  1.1.7.2 Subfamily: CREB-3-like factors TGACGTCA  
  1.1.7.2.1 CREB-3 (Luman) UniProt  ProteinAtlas T17586 UniProt UniProtF  
  1.1.7.2.2 CREB-3L1 (OASIS) UniProt  ProteinAtlas T18852 UniProt UniProt  
  1.1.7.2.3 CREB-3L2 UniProt  ProteinAtlas T19891 UniProt UniProt  
  1.1.7.2.4 CREB-3L3 (CREB-H)   UniProt  ProteinAtlas T18859 UniProt UniProt  
  1.1.7.2.5 CREB-3L4   UniProt  ProteinAtlas T18865 UniProt UniProt  
  1.1.7.3 Subfamily: ATF-6 factors TGACGTGG  
  1.1.7.3.1 ATF-6α   UniProt  ProteinAtlas T04742 UniProt UniProt  
  1.1.7.3.2 ATF-6β   UniProt  ProteinAtlas T18793 UniProt UniProt  
  1.1.7.4 Subfamily: CREBZF-like factors TGACGTCA  
  1.1.7.4.1 CREBZF (Zhangfei, ZF)   UniProt  ProteinAtlas T27189 UniProt UniProt  
  1.1.7.5 Subfamily: CREBL2-like factors TGACGTCA  
  1.1.7.5.1 CREBL2   UniProt  ProteinAtlas T19895 UniProt UniProt  
  1.1.8 Family: C/EBP-related ATTGCGCAAT  
  1.1.8.1 Subfamily: C/EBP ATTGCGCAAT  
  1.1.8.1.1 C/EBPα   UniProt  ProteinAtlas T00105 UniProt UniProt PDB
  1.1.8.1.2 C/EBPβ (NF-IL6-1) UniProt  ProteinAtlas T00581 UniProt UniProt PDB
  1.1.8.1.3 C/EBPγ UniProt  ProteinAtlas T04884 UniProt UniProt  
  1.1.8.1.4 C/EBPδ UniProt  ProteinAtlas T00583 UniProt UniProt  
  1.1.8.1.5 C/EBPε UniProt  ProteinAtlas T04883 UniProt UniProt  
  1.1.8.1.6 DDIT3 (CHOP-10)   UniProt  ProteinAtlas T01387 UniProt UniProt  
  1.1.8.2 Subfamily: PAR factors TTATGCAA  
  1.1.8.2.1 DBP UniProt  ProteinAtlas T04875 UniProt UniProt  
  1.1.8.2.2 HLF UniProt  ProteinAtlas T01071 UniProt UniProt  
  1.1.8.2.3 TEF UniProt  ProteinAtlas T19307 UniProt UniProt  
  1.1.8.2.4 NF-IL3 (E4BP4) UniProt  ProteinAtlas T01428 UniProt UniProt  
  1.1.8.3 Subfamily: CREBRF-like factors    
  1.1.8.3.1 CREBRF UniProt  ProteinAtlas HumanPSD UniProt UniProt  
  1.1.0 Family: ZIP only    
  1.1.0.1 Subfamily: TSC22    
  1.1.0.1.1 TSC22D1 (TSC-22, Cerebral protein 2)   UniProt  ProteinAtlas T27178 UniProt UniProt  
  1.1.0.1.2 TSC22D2 (TILZ4)   UniProt  ProteinAtlas T27317 UniProt UniProt  
  1.1.0.1.3 TSC22D3 (DSIPI, GILZ)   UniProt  ProteinAtlas HumanPSD UniProt UniProt  
  1.1.0.1.4 TSC22D4 (TILZ2)   UniProt  ProteinAtlas T27232 UniProt UniProt  
  1.1.0.2 Subfamily: UTF    
  1.1.0.2.1 UTF1   UniProt  ProteinAtlas T27333 UniProt UniProt  
  1.2 Class: Basic helix-loop-helix factors (bHLH) TRANSFAC class description Further information  
  1.2.1 Family: E2A-related factors CAGGTG  
  1.2.1.0.1 E2A (TCF-3, ITF-1) UniProt  ProteinAtlas T15605 UniProt UniProt PDB
  1.2.1.0.2 SEF2 (E2-2, TCF-4, ITF-2) UniProt  ProteinAtlas T00433 UniProt UniProt  
  1.2.1.0.3 HTF-4 (TCF-12, HEB)   UniProt  ProteinAtlas T01503 UniProt UniProt  
  1.2.2 Family: MyoD / ASC-related factors CAGGTG  
  1.2.2.1 Subfamily: Myogenic transcription factors    
  1.2.2.1.1 MyoD   UniProt  ProteinAtlas T00525 UniProt UniProt PDB
  1.2.2.1.2 Myogenin (Myf-4)   UniProt  ProteinAtlas T00520 UniProt UniProt  
  1.2.2.1.3 Myf-5   UniProt  ProteinAtlas T00521 UniProt UniProt  
  1.2.2.1.4 Myf-6 (MRF4) UniProt  ProteinAtlas T00522 UniProt UniProt  
  1.2.2.2 Subfamily: Achaete-Scute-like factors    
  1.2.2.2.1 ASH-1 (ASCL1)   UniProt  ProteinAtlas T21922 UniProt UniProt  
  1.2.2.2.2 ASH-2 (ASCL2) UniProt  ProteinAtlas T23527 UniProt UniProt  
  1.2.2.2.3 ASH-3 (ASCL3)   UniProt  ProteinAtlas T19841 UniProt UniProt  
  1.2.2.2.4 ASH-4 (ASCL4)   UniProt  ProteinAtlas T19845 UniProt UniProt  
  1.2.2.2.5 ASH-5 (ASCL5)   UniProt  ProteinAtlas T21452 UniProt UniProt  
  1.2.3 Family: Tal-related factors CAGCTG  
  1.2.3.1 Subfamily: Tal / HEN-like factors CAGCTG  
  1.2.3.1.1 Tal-1 (SCL, TCL-5)   UniProt  ProteinAtlas T19290 UniProt UniProt PDB
  1.2.3.1.2 Tal-2   UniProt  ProteinAtlas T01630 UniProt UniProt  
  1.2.3.1.3 Lyl-1   UniProt  ProteinAtlas T01632 UniProt UniProt  
  1.2.3.1.4 HEN1 (NSCL-1, NHLH1) UniProt  ProteinAtlas T01654 UniProt UniProt  
  1.2.3.1.5 HEN2 (NSCL-2, NHLH2)   UniProt  ProteinAtlas T01656 UniProt UniProt  
  1.2.3.2 Subfamily: Twist-like factors CGTCTG  
  1.2.3.2.1 Twist-1 (H-Twist, M-Twist)   UniProt  ProteinAtlas T04913 UniProt UniProt  
  1.2.3.2.2 Twist-2 (Dermo-1)   UniProt  ProteinAtlas T05820 UniProt UniProt  
  1.2.3.2.3 HAND-1 (eHAND, Th1)   UniProt  ProteinAtlas T04373 UniProt UniProt  
  1.2.3.2.4 HAND-2 (dHAND)   UniProt  ProteinAtlas T04374 UniProt UniProt  
  1.2.3.2.5 bHLH-EC2 (TCF-15)   UniProt  ProteinAtlas T01637 UniProt UniProt  
  1.2.3.2.6 Scx   UniProt  ProteinAtlas T19230 UniProt UniProt  
  1.2.3.2.7 PTF-1a   UniProt  ProteinAtlas T17051 UniProt UniProt  
  1.2.3.2.8 FIGα UniProt  ProteinAtlas T15609 UniProt UniProt  
  1.2.3.3 Subfamily: Mesp-like factors    
  1.2.3.3.1 Mesp-1 UniProt  ProteinAtlas T20011 UniProt UniProt  
  1.2.3.3.2 Mesp-2   UniProt  ProteinAtlas T20015 UniProt UniProt  
  1.2.3.3.3 TCF-23   UniProt  ProteinAtlas T23529 UniProt UniProt  
  1.2.3.3.4 ABF-1 (Musculin, MyoR, MSC) UniProt  ProteinAtlas T04902 UniProt UniProt  
  1.2.3.3.5 Pod-1 (TCF-21) UniProt  ProteinAtlas T04912 UniProt UniProt  
  1.2.3.3.6 Mesogenin-1 (MSGN1)   UniProt  ProteinAtlas T20024 UniProt UniProt  
  1.2.3.3.7 TCF-24   UniProt  ProteinAtlas HumanPSD UniProt UniProt  
  1.2.3.4 Subfamily: Neurogenin / Atonal-like factors CAGCTG  
  1.2.3.4.1 NeuroD1   UniProt  ProteinAtlas T04546 UniProt UniProt PDB
  1.2.3.4.2 NeuroD2 UniProt  ProteinAtlas T04903 UniProt UniProt  
  1.2.3.4.3 NeuroD4 (ATH-3)   UniProt  ProteinAtlas T20044 UniProt UniProt  
  1.2.3.4.4 NeuroD6 (ATH-2)   UniProt  ProteinAtlas T19116 UniProt UniProt  
  1.2.3.4.5 NGN-1 (NeuroD3)   UniProt  ProteinAtlas T04907 UniProt UniProt  
  1.2.3.4.6 NGN-2 (Atoh4, NeuroG2) UniProt  ProteinAtlas T19133 UniProt UniProt  
  1.2.3.4.7 NGN-3 (Atoh5, NeuroG3)   UniProt  ProteinAtlas T06057 UniProt UniProt  
  1.2.3.4.8 ATH-1 (ATOH-1) UniProt  ProteinAtlas T04544 UniProt UniProt  
  1.2.3.4.9 ATH-5 (ATOH-7)   UniProt  ProteinAtlas T18801 UniProt UniProt  
  1.2.3.4.10 ATH-6 (ATOH-8)   UniProt  ProteinAtlas T19849 UniProt UniProt  
  1.2.3.4.11 bHLHe22 (Beta3) UniProt  ProteinAtlas T23531 UniProt UniProt  
  1.2.3.4.12 bHLHe23 UniProt  ProteinAtlas T23533 UniProt UniProt  
  1.2.3.4.13 OLIGO1 UniProt  ProteinAtlas T05855 UniProt UniProt  
  1.2.3.4.14 OLIGO2 UniProt  ProteinAtlas T05841 UniProt UniProt  
  1.2.3.4.15 OLIGO3 UniProt  ProteinAtlas T20052 UniProt UniProt  
  1.2.3.4.16 MIST1 (bHLHa15) UniProt  ProteinAtlas T23535 UniProt UniProt  
  1.2.3.4.17 Fer3L (Ferd3L)   UniProt  ProteinAtlas T19923 UniProt UniProt  
  1.2.3.5 Subfamily: bHLHa9-like factors    
  1.2.3.5.1 bHLHa9   UniProt  ProteinAtlas T23537 UniProt UniProt  
  1.2.4 Family: Hairy-related factors CACGAG  
  1.2.4.1 Subfamily: Hairy-like factors CACGAG  
  1.2.4.1.1 HES-1   UniProt  ProteinAtlas T09895 UniProt UniProt PDB
  1.2.4.1.2 HES-2   UniProt  ProteinAtlas T06052 UniProt UniProt  
  1.2.4.1.3 HES-3   UniProt  ProteinAtlas T19980 UniProt UniProt  
  1.2.4.1.4 HES-4   UniProt  ProteinAtlas T19982      
  1.2.4.1.5 HES-5 UniProt  ProteinAtlas T18963 UniProt UniProt  
  1.2.4.1.6 HES-6   UniProt  ProteinAtlas T23540 UniProt UniProt  
  1.2.4.1.7 HES-7 UniProt  ProteinAtlas T18967 UniProt UniProt  
  1.2.4.1.8 HEY-1 UniProt  ProteinAtlas T05085 UniProt UniProt  
  1.2.4.1.9 HEY-2 UniProt  ProteinAtlas T05084 UniProt UniProt  
  1.2.4.1.10 HEYL   UniProt  ProteinAtlas T05086 UniProt UniProt  
  1.2.4.1.11 HELT   UniProt  ProteinAtlas T19977 UniProt UniProt  
  1.2.4.1.12 DEC1 (STRA-13, bHLHb2, bHLHe40) UniProt  ProteinAtlas T05838 UniProt UniProt  
  1.2.4.1.13 DEC2 (bHLHb3, bHLHe41) UniProt  ProteinAtlas T05839 UniProt UniProt  
  1.2.5 Family: PAS domain factors CACGC  
  1.2.5.1 Subfamily: Ahr-like factors CACGC  
  1.2.5.1.1 AhR   UniProt  ProteinAtlas T01795 UniProt UniProt PDB
  1.2.5.1.2 AhRR   UniProt  ProteinAtlas T18742 UniProt UniProt PDB
  1.2.5.1.3 SIM1   UniProt  ProteinAtlas T03729 UniProt UniProt  
  1.2.5.1.4 SIM2   UniProt  ProteinAtlas T04910 UniProt UniProt  
  1.2.5.1.5 HIF-1α   UniProt  ProteinAtlas T01610 UniProt UniProt PDB
  1.2.5.1.6 HIF-3α   UniProt  ProteinAtlas T18979 UniProt UniProt  
  1.2.5.1.7 EPAS-1   UniProt  ProteinAtlas T02718 UniProt UniProt  
  1.2.5.1.8 NPAS-1   UniProt  ProteinAtlas T04908 UniProt UniProt  
  1.2.5.1.9 NPAS-3   UniProt  ProteinAtlas T05873 UniProt UniProtF  
  1.2.5.2 Subfamily: Arnt-like factors CACGTG  
  1.2.5.2.1 Arnt (HIF-1β)   UniProt  ProteinAtlas T10835 UniProt UniProt PDB
  1.2.5.2.2 Arnt-2   UniProt  ProteinAtlas T05059 UniProt UniProt  
  1.2.5.2.3 ArntL (BMAL1) UniProt  ProteinAtlas T02720 UniProt UniProt PDB
  1.2.5.2.4 ArntL2 (BMAL2)   UniProt  ProteinAtlas T05872 UniProt UniProt  
  1.2.5.2.5 CLOCK UniProt  ProteinAtlas T04891 UniProt UniProt PDB
  1.2.5.2.6 NPAS-2   UniProt  ProteinAtlas T04909 UniProt UniProt  
  1.2.5.3 Subfamily: NCoA factors      
  1.2.5.3.1 NCoA-1 (SRC-1)   UniProt  ProteinAtlas T04632 UniProt UniProt  
  1.2.5.3.2 NCoA-2   UniProt  ProteinAtlas T02483 UniProt UniProt  
  1.2.5.3.3 NCoA-3   UniProt  ProteinAtlas T04640 UniProt UniProt  
  1.2.5.4 Subfamily: NPAS-4 CACGA  
  1.2.5.4.1 NPAS-4   UniProt  ProteinAtlas T22467 UniProt UniProt  
  1.2.5.5 Subfamily: SOHLH-like factors    
  1.2.5.5.1 SOHLH1 (TEB2)   UniProt  ProteinAtlas T20115 UniProt UniProt  
  1.2.5.5.2 SOHLH2 (TEB1)   UniProt  ProteinAtlas T19244 UniProt UniProt  
  1.2.5.5.3 TCFL5 (Cha, E2BP-1)   UniProt  ProteinAtlas T20143 UniProt UniProtF  
  1.2.6 Family: bHLH-ZIP factors CACATG  
  1.2.6.1 Subfamily: TFE3-like factors CACATG  
  1.2.6.1.1 TFE3 UniProt  ProteinAtlas T00811 UniProt UniProt  
  1.2.6.1.2 TFEB UniProt  ProteinAtlas T10290 UniProt UniProt  
  1.2.6.1.3 TFEC UniProt  ProteinAtlas T06414 UniProt UniProt  
  1.2.6.1.4 MiTF   UniProt  ProteinAtlas T01553 UniProt UniProt  
  1.2.6.2 Subfamily: USF factors CACGTG  
  1.2.6.2.1 USF-1 UniProt  ProteinAtlas T00874 UniProt UniProt PDB
  1.2.6.2.2 USF-2   UniProt  ProteinAtlas T00878 UniProt UniProt  
  1.2.6.2.3 USF-3   UniProt  ProteinAtlas HumanPSD UniProt UniProt  
  1.2.6.3 Subfamily: SREBP factors ATCACCCCAC  
  1.2.6.3.1 SREBP-1 (SREBF1) UniProt  ProteinAtlas T08912 UniProt UniProt PDB
  1.2.6.3.2 SREBP-2 (SREBF2) UniProt  ProteinAtlas T01560 UniProt UniProt PDB
  1.2.6.4 Subfamily: AP-4 CAGCTG  
  1.2.6.4.1 AP-4 UniProt  ProteinAtlas T00036 UniProt UniProt  
  1.2.6.5 Subfamily: Myc / Max factors CACGTG  
  1.2.6.5.1 c-Myc   UniProt  ProteinAtlas T09998 UniProt UniProt PDB
  1.2.6.5.2 N-Myc   UniProt  ProteinAtlas T02379 UniProt UniProt  
  1.2.6.5.3 L-Myc-1   UniProt  ProteinAtlas T11298 UniProt UniProt  
  1.2.6.5.4 L-Myc-2 (MYCLP1)   UniProt   T03539      
  1.2.6.5.5 Max UniProt  ProteinAtlas T05056 UniProt UniProt PDB
  1.2.6.6 Subfamily: Mondo-like factors CACGTG  
  1.2.6.6.1 Mlx UniProt  ProteinAtlas T05060 UniProt UniProt  
  1.2.6.6.2 MondoA (Mlx-IP)   UniProt  ProteinAtlas T19089 UniProt UniProt  
  1.2.6.6.3 MondoB (Mlx-IPL, WS-bHLH) UniProt  ProteinAtlas T05121 UniProt UniProt  
  1.2.6.7 Subfamily: Mad1-like factors CACGTG  
  1.2.6.7.1 Mad1 (MXD1)   UniProt  ProteinAtlas T01565 UniProt UniProt PDB
  1.2.6.7.2 Mad3 (MXD3)   UniProt  ProteinAtlas T19044 UniProt UniProt  
  1.2.6.7.3 Mad4 (MXD4)   UniProt  ProteinAtlas T19050 UniProt UniProt  
  1.2.6.7.5 Mxi-1   UniProt  ProteinAtlas T01564 UniProt UniProt  
  1.2.6.7.6 Mnt UniProt  ProteinAtlas T03268 UniProt UniProtF  
  1.2.6.8 Subfamily: Mad5-like factors CACGTG  
  1.2.6.8.1 Mad5 (MGA) = 6.5.5.0.2   UniProt  ProteinAtlas T20017 UniProt UniProt  
  1.2.8 Family: HLH domain only    
  1.2.8.0.1 Id1   UniProt  ProteinAtlas T14419 UniProt UniProt  
  1.2.8.0.2 Id2   UniProt  ProteinAtlas T01212 UniProt UniProt  
  1.2.8.0.3 Id3   UniProt  ProteinAtlas T09205 UniProt UniProt  
  1.2.8.0.4 Id4 UniProt  ProteinAtlas T22493 UniProt UniProt  
  1.3 Class: Basic helix-span-helix factors (bHSH) TRANSFAC class description Further information  
  1.3.1 Family: AP-2 GCCTGAGGC  
  1.3.1.0.1 AP-2α UniProt  ProteinAtlas T08146 UniProt UniProt  
  1.3.1.0.2 AP-2β UniProt  ProteinAtlas T02467 UniProt UniProt  
  1.3.1.0.3 AP-2γ UniProt  ProteinAtlas T02468 UniProt UniProt  
  1.3.1.0.4 AP-2δ   UniProt  ProteinAtlas T16063 UniProt UniProt  
  1.3.1.0.5 AP-2ε   UniProt  ProteinAtlas T19673 UniProt UniProt  

2 Superclass: Zinc-coordinating DNA-binding domains TRANSFAC class description  
  2.1 Class: Nuclear receptors with C4 zinc fingers TRANSFAC class description Further information  
  2.1.1 Family: Steroid hormone receptors (NR3)    
  2.1.1.1 Subfamily: GR-like receptors (NR3C) AGAACATGATGTTCT  
  2.1.1.1.1 Glucocorticoid receptor (GR) (NR3C1) UniProt  ProteinAtlas T05076 UniProt UniProt PDB
  2.1.1.1.2 Mineralocorticoid receptor (MR) (NR3C2) UniProt  ProteinAtlas T00513 UniProt UniProt  
  2.1.1.1.3 Progesterone receptor (PR) (NR3C3)   UniProt  ProteinAtlas T05742 UniProt UniProt PDB
  2.1.1.1.4 Androgen receptor (AR) (NR3C4) UniProt  ProteinAtlas T00040 UniProt UniProt PDB
  2.1.1.2 Subfamily: ER-like receptors (NR3A&B) AGGTCACAGTGACCT  
  2.1.1.2.1 Estrogen receptor α (ERα) (ESR1, NR3A1) UniProt  ProteinAtlas T00261 UniProt UniProt PDB
  2.1.1.2.2 Estrogen receptor β (ERβ) (NR3A2)   UniProt  ProteinAtlas T08515 UniProt UniProt  
  2.1.1.2.3 ERR1 (ERRα, ESRRA) (NR3B1) UniProt  ProteinAtlas T02765 UniProt UniProt  
  2.1.1.2.4 ERR2 (ERRβ, ESRRB) (NR3B2) UniProt  ProteinAtlas T14091 UniProt UniProt PDB
  2.1.1.2.5 ERR3 (ERRγ, ESRRG) (NR3B3) UniProt  ProteinAtlas T06121 UniProt UniProt  
  2.1.2 Family: Thyroid hormone receptor-related factors (NR1)    
  2.1.2.1 Subfamily: Retinoic acid receptors (NR1B) TGACCTTTGACCT  
  2.1.2.1.1 RAR-α (NR1B1) UniProt  ProteinAtlas T05299 UniProt UniProt PDB
  2.1.2.1.2 RAR-β (NR1B2) UniProt  ProteinAtlas T00721 UniProt UniProt  
  2.1.2.1.3 RAR-γ (NR1B3) UniProt  ProteinAtlas T00720 UniProt UniProt  
  2.1.2.2 Subfamily: Thyroid hormone receptors (NR1A) TGACCTGAAATGACCT  
  2.1.2.2.1 T3R-α (THRA) (NR1A1) UniProt  ProteinAtlas T00838 UniProt UniProt  
  2.1.2.2.2 T3R-β (NR1A2) UniProt  ProteinAtlas T08264 UniProt UniProt PDB
  2.1.2.3 Subfamily: Rev-ErbA (NR1D) TGACCTAGTGACCT  
  2.1.2.3.1 Rev-ErbAα (NR1D1)   UniProt  ProteinAtlas T02746 UniProt UniProt  
  2.1.2.3.2 Rev-ErbAβ (NR1D2)   UniProt  ProteinAtlas T19134 UniProt UniProt  
  2.1.2.4 Subfamily: Vitamin D receptor (NR1I) TGACCTTCGTGACCT  
  2.1.2.4.1 VDR (NR1I1) UniProt  ProteinAtlas T00885 UniProt UniProt PDB
  2.1.2.4.2 PXR (NR1I2)   UniProt  ProteinAtlas T08949 UniProt UniProt  
  2.1.2.4.3 CAR (NR1I3)   UniProt  ProteinAtlas T02261 UniProt UniProt  
  2.1.2.5 Subfamily: PPAR (NR1C) TGACCTTTGACCT  
  2.1.2.5.1 PPARα (NR1C1)   UniProt  ProteinAtlas T02726 UniProt UniProt  
  2.1.2.5.2 PPARβ (PPARδ) (NR1C2)   UniProt  ProteinAtlas T02745 UniProt UniProt PDB
  2.1.2.5.3 PPARγ (NR1C3)   UniProt  ProteinAtlas T05351 UniProt UniProt PDB
  2.1.2.6 Subfamily: ROR (NR1F) TGACCTACTTAT  
  2.1.2.6.1 RORα (NR1F1) UniProt  ProteinAtlas T09566 UniProt UniProtF  
  2.1.2.6.2 RORβ (NR1F2)   UniProt  ProteinAtlas T02748 UniProt UniProt  
  2.1.2.6.3 RORγ (NR1F3)   UniProt  ProteinAtlas T02749 UniProt UniProt  
  2.1.2.7 Subfamily: LXR (NR1H) TGACCTCTACTGACCT  
  2.1.2.7.1 LXRα (NR1H3)   UniProt  ProteinAtlas T02752 UniProt UniProt  
  2.1.2.7.2 LXRβ (NR1H2)   UniProt  ProteinAtlas T04453 UniProt UniProt PDB
  2.1.2.7.3 FXR (NR1H4)   UniProt  ProteinAtlas T09632 UniProt UniProt  
  2.1.3 Family: RXR-related receptors (NR2) (TGACCT)  
  2.1.3.1 Subfamily: Retinoid X receptors (NR2B) (TGACCT)  
  2.1.3.1.1 RXRα (NR2B1) UniProt  ProteinAtlas T01345 UniProt UniProt PDB
  2.1.3.1.2 RXRβ (NR2B2) UniProt  ProteinAtlas T01334 UniProt UniProtF  
  2.1.3.1.3 RXRγ (NR2B3) UniProt  ProteinAtlas T04807 UniProt UniProt  
  2.1.3.2 Subfamily: HNF-4 (NR2A) AGTCCAAAGTTCA  
  2.1.3.2.1 HNF-4α (NR2A1) UniProt  ProteinAtlas T03828 UniProt UniProt PDB
  2.1.3.2.2 HNF-4γ (NR2A2)   UniProt  ProteinAtlas T02430 UniProt UniProt  
  2.1.3.3 Subfamily: Tailless-like receptors (NR2E) TGACCTTTGACCT  
  2.1.3.3.1 Tlx (NR2E1) UniProt  ProteinAtlas T04808 UniProt UniProt  
  2.1.3.3.2 PNR (NR2E3)   UniProt  ProteinAtlas T03723 UniProt    
  2.1.3.4 Subfamily: Testicular receptors (NR2C) TGACCTCTGACCT  
  2.1.3.4.1 TR2 (NR2C1)   UniProt  ProteinAtlas T19142 UniProt UniProt  
  2.1.3.4.2 TR4 (NR2C2) UniProt  ProteinAtlas T02740 UniProt UniProt  
  2.1.3.5 Subfamily: COUP-like receptors (NR2F) TGACCTTTGACCT  
  2.1.3.5.1 COUP-TFI (NR2F1) UniProt  ProteinAtlas T00149 UniProt UniProt PDB
  2.1.3.5.2 COUP-TFII (NR2F2)   UniProt  ProteinAtlas T00045 UniProt UniProt  
  2.1.3.5.3 EAR2 (NR2F6) UniProt  ProteinAtlas T02763 UniProt UniProt  
  2.1.4 Family: NGFI-B-related receptors (NR4) TGACCTTT  
  2.1.4.0.1 NGFI-B (NR4A1)   UniProt  ProteinAtlas T02767 UniProt UniProt PDB
  2.1.4.0.2 NURR1 (NR4A2) UniProt  ProteinAtlas T02742 UniProt UniProt  
  2.1.4.0.3 NOR1 (NR4A3)   UniProt  ProteinAtlas T15532 UniProt UniProt  
  2.1.5 Family: FTZ-F1-related receptors (NR5) TGACCTTG  
  2.1.5.0.1 FTZ-F1 (SF-1) (NR5A1)   UniProt  ProteinAtlas T02769 UniProt UniProt PDB
  2.1.5.0.2 LRH-1 (NR5A2)   UniProt  ProteinAtlas T02770 UniProt UniProt PDB
  2.1.6 Family: GCNF-related receptors (NR6) TGAACTTGACTTGA  
  2.1.6.0.1 GCNF (NR6A1)   UniProt  ProteinAtlas T15691 UniProt UniProtF  
  2.1.7 Family: DAX-related receptors (NR0) TGACCTT  
  2.1.7.0.1 DAX1 (NR0B1)   UniProt  ProteinAtlas T02776 UniProt UniProt  
  2.1.7.0.2 SHP (NR0B2)   UniProt  ProteinAtlas T02738 UniProt UniProt  
  2.2 Class: Other C4 zinc finger-type factors TRANSFAC class description Further information  
  2.2.1 Family: GATA-type zinc fingers    
  2.2.1.1 Subfamily: Two zinc-finger GATA factors AGATAA  
  2.2.1.1.1 GATA-1 (GF-1, EryF1, NF-E1)   UniProt  ProteinAtlas T00306 UniProt UniProt PDB
  2.2.1.1.2 GATA-2   UniProt  ProteinAtlas T00308 UniProt UniProt  
  2.2.1.1.3 GATA-3 UniProt  ProteinAtlas T09925 UniProt UniProt PDB
  2.2.1.1.4 GATA-4 UniProt  ProteinAtlas T02687 UniProt UniProt PDB
  2.2.1.1.5 GATA-5 UniProt  ProteinAtlas T18947 UniProt UniProt  
  2.2.1.1.6 GATA-6   UniProt  ProteinAtlas T02689 UniProt UniProt  
  2.2.1.2 Subfamily: Single GATA-type zinc-finger AGATAA  
  2.2.1.2.1 GATAD1 (ODAG)   UniProt  ProteinAtlas T27293 UniProt UniProt  
  2.2.1.2.2 p66-α (GATAD2A)   UniProt  ProteinAtlas T27302 UniProt UniProt  
  2.2.1.2.3 p66-β (GATAD2B)   UniProt  ProteinAtlas T27167 UniProt UniProt  
  2.2.1.2.4 RERE (ARG, ARP, ATN1L) = 3.5.1.3.7   UniProt  ProteinAtlas T22414 UniProt UniProt  
  2.2.1.2.5 MTA1 = 3.5.1.3.4   UniProt  ProteinAtlas T10759 UniProt UniProt  
  2.2.1.2.6 MTA2 (MTA1L1, PID) = 3.5.1.3.5   UniProt  ProteinAtlas T05115 UniProt UniProt  
  2.2.1.2.7 MTA3 = 3.5.1.3.6   UniProt  ProteinAtlas T22427 UniProt UniProtF  
  2.2.1.2.8 ZGLP1 (GLP-1)   UniProt  ProteinAtlas T27342 UniProt UniProt  
  2.2.1.2.9 DNMT3A   UniProt  ProteinAtlas T27195 UniProt UniProt PDB
  2.2.1.2.10 DNMT3B   UniProt  ProteinAtlas T27198 UniProt UniProt  
  2.2.1.2.11 DNMT3L   UniProt  ProteinAtlas T27172 UniProt UniProt PDB
  2.2.1.2.12 ATRX (RAD54L, XH2)   UniProt  ProteinAtlas T27182 UniProt UniProt PDB
  2.2.1.2.13 TRPS1 (GC79) = 2.3.4.0.20   UniProt  ProteinAtlas T17430 UniProt UniProt  
  2.3 Class: C2H2 zinc finger factors TRANSFAC class description Further information  
  2.3.1 Family: Three-zinc finger Krüppel-related factors    
  2.3.1.1 Subfamily: Sp1-like factors GGGGCGGGG  
  2.3.1.1.1 Sp1 UniProt  ProteinAtlas T00759 UniProt UniProt PDB
  2.3.1.1.2 Sp2   UniProt  ProteinAtlas T02356 UniProt UniProt  
  2.3.1.1.3 Sp3 UniProt  ProteinAtlas T02338 UniProt UniProtF  
  2.3.1.1.4 Sp4 UniProt  ProteinAtlas T02339 UniProt UniProt  
  2.3.1.1.5 Sp5   UniProt  ProteinAtlas T19264 UniProt UniProt  
  2.3.1.1.6 Sp6   UniProt  ProteinAtlas T20128 UniProt UniProt  
  2.3.1.1.7 Sp7 (OSX)   UniProt  ProteinAtlas T20130 UniProt UniProt  
  2.3.1.1.8 Sp8 UniProt  ProteinAtlas T23574 UniProt UniProt  
  2.3.1.1.9 Sp9   UniProt  ProteinAtlas T23578 UniProt UniProt  
  2.3.1.2 Subfamily: Krüppel-like factors CCACACCCT  
  2.3.1.2.1 KLF1 (EKLF)   UniProt  ProteinAtlas T04957 UniProt UniProt  
  2.3.1.2.2 KLF2 (LKLF)   UniProt  ProteinAtlas T04958 UniProt UniProt  
  2.3.1.2.3 KLF3 (BKLF)   UniProt  ProteinAtlas T10298 UniProt UniProt PDB
  2.3.1.2.4 KLF4 (GKLF)   UniProt  ProteinAtlas T14243 UniProt UniProt PDB
  2.3.1.2.5 KLF5 (CKLF, IKLF, BTEB2)   UniProt  ProteinAtlas T02211 UniProt UniProt PDB
  2.3.1.2.6 KLF6 (CPBP, BCD1)   UniProt  ProteinAtlas T04964 UniProt UniProt  
  2.3.1.2.7 KLF7 (UKLF)   UniProt  ProteinAtlas T04960 UniProt UniProtF  
  2.3.1.2.8 KLF8 (BKLF)   UniProt  ProteinAtlas T19039 UniProt UniProt  
  2.3.1.2.9 KLF9 (BTEB1)   UniProt  ProteinAtlas T02212 UniProt UniProt  
  2.3.1.2.10 KLF10 (TIEG1)   UniProt  ProteinAtlas T04955 UniProt UniProt PDB
  2.3.1.2.11 KLF11 (FKLF, TIEG2)   UniProt  ProteinAtlas T04956 UniProt UniProt  
  2.3.1.2.12 KLF12 (AP-2rep) UniProt  ProteinAtlas T04686 UniProt UniProt  
  2.3.1.2.13 KLF13 (BTEB3, NSLP1) UniProt  ProteinAtlas T05051 UniProt UniProt  
  2.3.1.2.14 KLF14 (BTEB5) UniProt  ProteinAtlas T19998 UniProt UniProt  
  2.3.1.2.15 KLF15 (KKLF)   UniProt  ProteinAtlas T05058 UniProt UniProt PDB
  2.3.1.2.16 KLF16 (BTEB4, NSLP2) UniProt  ProteinAtlas T06146 UniProt UniProt  
  2.3.1.2.17 KLF17   UniProt  ProteinAtlas T10977 UniProt UniProt  
  2.3.1.3 Subfamily: EGR factors GCGTGGGCG  
  2.3.1.3.1 EGR1 (Krox-24, Zif268) UniProt  ProteinAtlas T00241 UniProt UniProt PDB
  2.3.1.3.2 EGR2 (Krox-20) UniProt  ProteinAtlas T00242 UniProt UniProt  
  2.3.1.3.3 EGR3 (PILOT) UniProt  ProteinAtlas T00243 UniProt UniProt  
  2.3.1.3.4 EGR4 UniProt  ProteinAtlas T05190 UniProt UniProt  
  2.3.2 Family: Other factors with up to three adjacent zinc fingers    
  2.3.2.1 Subfamily: Factors with 2-3 adjacent zinc fingers
and a BTB/POZ domain
TCCTGCTA  
  2.3.2.1.1 ZBTB5 [2]   UniProt  ProteinAtlas T16315 UniProt UniProt  
  2.3.2.1.2 ZBTB8B [2]   UniProt  ProteinAtlas T23585 UniProt UniProt  
  2.3.2.1.6 ZBTB22 (ZNF297, BING1) [3]   UniProt  ProteinAtlas T19375 UniProt UniProt  
  2.3.2.1.7 ZBTB32 (ZNF538, FAZF) [3]   UniProt  ProteinAtlas T19382 UniProt UniProt  
  2.3.2.1.8 ZBTB34 [3]   UniProt  ProteinAtlas T20227 UniProt UniProt  
  2.3.2.1.9 ZBTB37 [3]   UniProt  ProteinAtlas T20229 UniProt UniProt  
  2.3.2.1.10 ZBTB43 (ZBTB22B, ZNF297B) [3]   UniProt  ProteinAtlas T19384 UniProt UniProt PDB
  2.3.2.1.11 ZBTB46 (BTBD4, ZNF340) [2]   UniProt  ProteinAtlas T23588 UniProt UniProt  
  2.3.2.1.12 ZBTB33 (KAISO, ZNF348) [3]   UniProt  ProteinAtlas T08297 UniProt UniProt PDB
  2.3.2.2 Subfamily: Factors with 2-3 adjacent zinc fingers
and a KRAB domain
   
  2.3.2.2.1 ZNF487 [3]   UniProt  ProteinAtlas HumanPSD      
  2.3.2.2.2 ZNF542 (ZNF542P) [2]   UniProt   T21413      
  2.3.2.2.3 ZNF705A [3]   UniProt  ProteinAtlas T20205      
  2.3.2.3 Subfamily: Factors with 2-3 adjacent zinc fingers
and a SCAN domain
   
  2.3.2.3.1 ZSCAN1 [3]   UniProt  ProteinAtlas T21242      
  2.3.2.3.2 ZNF174 (AW-1, ZSCAN8) [3]   UniProt  ProteinAtlas T02279      
  2.3.2.3.3 ZNF396 (ZSCAN14) [3]   UniProt  ProteinAtlas T20570      
  2.3.2.3.4 ZNF446 (ZKSCAN20) [3]   UniProt  ProteinAtlas T19499      
  2.3.2.4 Subfamily: Other three adjacent zinc finger factors    
  2.3.2.4.1 ZNF414 [3]   UniProt  ProteinAtlas T19479 UniProt UniProt  
  2.3.2.4.2 ZNF511 [3]   UniProt  ProteinAtlas T20692 UniProt UniProt  
  2.3.2.4.3 ZNF580 [3]   UniProt  ProteinAtlas T19525 UniProt UniProt  
  2.3.2.4.4 ZNF702P [3]   UniProt   T21502      
  2.3.2.4.5 ZNF740 (ZFP740) [3] UniProt  ProteinAtlas T23591 UniProt UniProt  
  2.3.2.4.6 ZFPM2 (ZNF89B, FOG2) = 2.7.2.0.2 [3]   UniProt  ProteinAtlas T18921 UniProt UniProtF  
  2.3.2.4.7 OSR1 (ODD) [3]   UniProt  ProteinAtlas T22428 UniProt UniProt  
  2.3.2.4.8 OVOL3 (OVL2L) [4]   UniProt  ProteinAtlas T23593 UniProt UniProtF, ?  
  2.3.2.4.9 AEBP2 [2]   UniProt  ProteinAtlas T18732 UniProt UniProt PDB
  2.3.3 Family: More than 3 adjacent zinc finger factors    
  2.3.3.1 Subfamily: GLI-like factors TGGGTGGTC  
  2.3.3.1.1 GLI1 [5]   UniProt  ProteinAtlas T00330 UniProt UniProt PDB
  2.3.3.1.2 GLI2 [5] UniProt  ProteinAtlas T11124 UniProt UniProt  
  2.3.3.1.3 GLI3 [5]   UniProt  ProteinAtlas T00331 UniProt UniProt  
  2.3.3.1.4 GLIS1 [5] UniProt  ProteinAtlas T19960 UniProt UniProt  
  2.3.3.1.5 GLIS2 (NKL) [5] UniProt  ProteinAtlas T05131 UniProt UniProt  
  2.3.3.1.6 GLIS3 (ZNF515) [5] UniProt  ProteinAtlas T18953 UniProt UniProt  
  2.3.3.1.7 ZIC1 (ZNF201) [5] UniProt  ProteinAtlas T06558 UniProt UniProt  
  2.3.3.1.8 ZIC2 [5]   UniProt  ProteinAtlas T04237 UniProt UniProt  
  2.3.3.1.9 ZIC3 (ZNF203) [5] UniProt  ProteinAtlas T20329 UniProt UniProt PDB
  2.3.3.1.10 ZIC4 [5] UniProt  ProteinAtlas T23596 UniProt UniProtF  
  2.3.3.1.11 ZIC5 [4]   UniProt  ProteinAtlas T23599 UniProt UniProt  
  2.3.3.2 Subfamily: Snail-like factors CACCTG  
  2.3.3.2.1 SNAI1 [4]   UniProt  ProteinAtlas T06312 UniProt UniProt PDB
  2.3.3.2.2 SNAI2 (SLUG) [5] UniProt  ProteinAtlas T05005 UniProt UniProt  
  2.3.3.2.3 SNAI3 (ZNF293) [5]   UniProt  ProteinAtlas T19240 UniProt UniProt  
  2.3.3.2.4 SCRT1 [5] UniProt  ProteinAtlas T20102 UniProt UniProt  
  2.3.3.2.5 SCRT2 [5] UniProt  ProteinAtlas T20106 UniProt UniProt  
  2.3.3.3 Subfamily: ZFP91-like factors    
  2.3.3.3.1 ZFP91 (ZNF757) [5]   UniProt  ProteinAtlas T20320 UniProt UniProt PDB
  2.3.3.3.2 ZNF692 [5]   UniProt  ProteinAtlas T19551 UniProt UniProt PDB
  2.3.3.3.3 ZNF276 (ZFP276, ZNF477) [5]   UniProt  ProteinAtlas T19452 UniProt UniProt  
  2.3.3.3.4 ZNF653 (ZIP67) [5]   UniProt  ProteinAtlas T20932 UniProt UniProt  
  2.3.3.4 Subfamily: ZNF280-like zinc finger factors    
  2.3.3.4.1 ZNF280A (SUHW1, ZNF280, ZNF636) [4]   UniProt  ProteinAtlas T20161      
  2.3.3.4.2 ZNF280B (SUHW2, ZNF279, ZNF632, Zfp280b, Zfp653) [4]   UniProt  ProteinAtlas T20163 UniProt UniProt  
  2.3.3.4.3 ZNF280C (SUHW3, ZNF633, Zfp280c) [5]   UniProt  ProteinAtlas T20165 UniProt UniProt  
  2.3.3.4.4 ZNF280D (SUHW4, ZNF634, Zfp280d) [5]   UniProt  ProteinAtlas T20171 UniProt UniProt  
  2.3.3.4.5 POGZ (SUHW5, ZNF280E, ZNF635) [9]   UniProt  ProteinAtlas T22515 UniProt UniProt PDB
  2.3.3.5 Subfamily: ZSCAN5-like zinc finger factors    
  2.3.3.5.1 ZSCAN5A (ZNF495) [5]   UniProt  ProteinAtlas T21223      
  2.3.3.5.2 ZSCAN5B [5]   UniProt  ProteinAtlas T21225      
  2.3.3.5.3 ZSCAN5C [5]   UniProt  ProteinAtlas T24062      
  2.3.3.5.4 ZSCAN5D (ZSCAN5DP) [5]   UniProt   HumanPSD      
  2.3.3.5.5 ZSCAN4 (ZNF494) [4] UniProt  ProteinAtlas T21251      
  2.3.3.6 Subfamily: ZNF75-like zinc finger factors    
  2.3.3.6.1 ZNF75A [5] UniProt  ProteinAtlas T21027      
  2.3.3.6.2 ZNF75C (ZNF75CP) [5]   UniProt   T21487      
  2.3.3.6.3 ZNF75D (ZNF82) [5]   UniProt  ProteinAtlas T21029      
  2.3.3.6.4 ZNF213 (ZKSCAN21) [5]   UniProt  ProteinAtlas T20427      
  2.3.3.7 Subfamily: ZNF705 factors    
  2.3.3.7.1 ZNF705D [3]   UniProt  ProteinAtlas T21358      
  2.3.3.7.2 ZNF705F [3]   UniProt   T24064      
  2.3.3.7.3 ZNF705G [2]   UniProt  ProteinAtlas T21340      
  2.3.3.7.4 ZNF705E [2]   UniProt  ProteinAtlas  HumanPSD      
  2.3.3.8 Subfamily: ZBTB7 factors GACCCC  
  2.3.3.8.1 ZBTB7A [4] UniProt  ProteinAtlas T08859 UniProt UniProt  
  2.3.3.8.2 ZBTB7B [4] UniProt  ProteinAtlas T10067 UniProt UniProt  
  2.3.3.8.3 ZBTB7C [4] UniProt  ProteinAtlas T23603 UniProt UniProt  
  2.3.3.9 Subfamily: YY1-like factors GCCATCTTG  
  2.3.3.9.1 YY1 [4] UniProt  ProteinAtlas T08660 UniProt UniProt PDB
  2.3.3.9.2 YY2 (ZNF631) [4] UniProt  ProteinAtlas T21350 UniProt UniProt  
  2.3.3.9.3 ZFP42 (REX1, ZNF754) [4]   UniProt  ProteinAtlas T18524 UniProt    
  2.3.3.10 Subfamily: ZNF24-like factors TCAT  
  2.3.3.10.1 ZNF24 (KOX17, ZNF191, ZSCAN3) [4]   UniProt  ProteinAtlas T04981 UniProt UniProt PDB
  2.3.3.10.2 ZNF193 (ZSCAN9) [5]   UniProt  ProteinAtlas T19428      
  2.3.3.10.3 ZSCAN23 (ZNF390, ZNF453) [5]   UniProt  ProteinAtlas T21235      
  2.3.3.10.4 GLI4 (HKR4) [7]   UniProt  ProteinAtlas T23606   UniProt  
  2.3.3.10.5 ZNF232 (ZSCAN1) [5] UniProt  ProteinAtlas T19436      
  2.3.3.10.6 ZKSCAN1 (KOX18, ZNF139, ZNF36) [6]   UniProt  ProteinAtlas T20341 UniProt UniProt  
  2.3.3.10.7 ZNF323 (ZNF310P, ZSCAN31) [6]   UniProt  ProteinAtlas T20520      
  2.3.3.11 Subfamily: ZBTB6-like factors    
  2.3.3.11.1 ZBTB6 (ZID, ZNF482) [4]   UniProt  ProteinAtlas T01468 UniProt UniProt  
  2.3.3.11.2 ZBTB26 (ZNF481) [4]   UniProt  ProteinAtlas T20225 UniProt UniProt  
  2.3.3.11.3 ZBTB12 (NG35) [4]   UniProt  ProteinAtlas T20216 UniProt UniProt  
  2.3.3.12 Subfamily: PRDM1-like factors AAGTGAAAGT  
  2.3.3.12.1 PRDM1 (BLIMP1) [4] UniProt  ProteinAtlas T00929 UniProt UniProt  
  2.3.3.12.2 ZNF683 [4]   UniProt  ProteinAtlas T20983      
  2.3.3.13 Subfamily: ZNF148-like factors CACCC  
  2.3.3.13.1 ZNF148 (ZBP89) [4]   UniProt  ProteinAtlas T10300 UniProt UniProt  
  2.3.3.13.2 ZNF281 (GZP1, ZBP99) [4]   UniProt  ProteinAtlas T04995 UniProt    
  2.3.3.14 Subfamily: ZBTB20-like factors    
  2.3.3.14.1 ZBTB20 (DPZF, ZNF288) [5]   UniProt  ProteinAtlas T20218 UniProt UniProt  
  2.3.3.14.2 ZBTB45 (ZNF499) [4]   UniProt  ProteinAtlas T19394 UniProt UniProt  
  2.3.3.15 Subfamily: ZNF524-like factors    
  2.3.3.15.1 ZNF524 [4] UniProt  ProteinAtlas T20722 UniProt    
  2.3.3.15.2 ZNF581 [4]   UniProt  ProteinAtlas T19529      
  2.3.3.16 Subfamily: ZNF238-like factors AACATCTGGA  
  2.3.3.16.1 ZNF238 (RP58, TAZ1, ZBTB18) [4] UniProt  ProteinAtlas T05040 UniProt UniProt  
  2.3.3.16.2 ZBTB42 [4]   UniProt  ProteinAtlas T23611 UniProt UniProt  
  2.3.3.17 Subfamily: OVOL-factors GCGGGGG  
  2.3.3.17.1 OVOL1 [4]   UniProt  ProteinAtlas T19164 UniProt UniProt  
  2.3.3.17.2 OVOL2 (ZNF339) [4]   UniProt  ProteinAtlas T19165 UniProt UniProt  
  2.3.3.18 Subfamily: ZNF56-like factors    
  2.3.3.18.1 ZNF56 (ZNF742) [3]   UniProt   T21392      
  2.3.3.18.2 ZNF876P [4]   UniProt   HumanPSD      
  2.3.3.18.3 ZNF138 [6]   UniProt  ProteinAtlas T21380      
  2.3.3.19 Subfamily: ZNF500-like factors    
  2.3.3.19.1 ZNF500 (ZKSCAN18) [5]   UniProt  ProteinAtlas T20676      
  2.3.3.19.2 ZNF853 [5]   UniProt  ProteinAtlas T24088      
  2.3.3.19.3 ZKSCAN2 (ZNF694) [6]   UniProt  ProteinAtlas T20346 UniProt UniProt  
  2.3.3.19.4 ZSCAN29 (ZNF690) [6]   UniProt  ProteinAtlas T21237 UniProt    
  2.3.3.19.5 ZNF434 (ZSCAN32) [6]   UniProt  ProteinAtlas T19491      
  2.3.3.20 Subfamily: FEZF factors    
  2.3.3.20.1 FEZF1 (ZNF312B) [6]   UniProt  ProteinAtlas T19927 UniProt UniProt  
  2.3.3.20.2 FEZF2 (FEZL, ZNF312) [6]   UniProt  ProteinAtlas T19933 UniProt UniProt  
  2.3.3.21 Subfamily: GFI1 factors AAATCACAGC  
  2.3.3.21.1 GFI1 (ZNF163) [6]   UniProt  ProteinAtlas T06587 UniProt UniProt PDB
  2.3.3.21.2 GFI1B [6]   UniProt  ProteinAtlas T06586 UniProt UniProt  
  2.3.3.22 Subfamily: BCL6 factors CTTTCTAGGAAT  
  2.3.3.22.1 BCL6B (BAZF, ZNF62) [5] UniProt  ProteinAtlas T23617 UniProt UniProt  
  2.3.3.22.2 BCL6 (LAZ3, ZBTB27, ZNF51) [6]   UniProt  ProteinAtlas T02322 UniProt UniProt PDB
  2.3.3.23 Subfamily: ZNF212-like factors    
  2.3.3.23.1 ZNF212 (ZNFC150) [4]   UniProt  ProteinAtlas T20425      
  2.3.3.23.2 ZNF777 [6]   UniProt  ProteinAtlas T21067      
  2.3.3.24 Subfamily: MTF1-like factors TGCACAC  
  2.3.3.24.1 MTF1 [6] UniProt  ProteinAtlas T02354 UniProt UniProt  
  2.3.3.24.2 ZNF410 (APA1) [5] UniProt  ProteinAtlas T19477 UniProt    
  2.3.3.25 Subfamily: PLAG factors    
  2.3.3.25.1 PLAGL2 [6]   UniProt  ProteinAtlas T04963 UniProt UniProt  
  2.3.3.25.2 PLAG1 [7]   UniProt  ProteinAtlas T20058 UniProt UniProt  
  2.3.3.25.3 PLAGL1 (LOT1, ZAC) [7]   UniProt  ProteinAtlas T10143 UniProt UniProt  
  2.3.3.26 Subfamily: ZKSCAN3-like factors TGAGGGG  
  2.3.3.26.1 ZKSCAN3 (ZFP47, ZNF306, ZNF309, ZSCAN13) [7] UniProt  ProteinAtlas T20349 UniProt UniProt  
  2.3.3.26.2 ZKSCAN4 (ZNF307, ZNF427) [7]   UniProt  ProteinAtlas T20351 UniProt UniProtF  
  2.3.3.27 Subfamily: ZNF525-like factors    
  2.3.3.27.1 ZNF525 [7]   UniProt  ProteinAtlas T21473      
  2.3.3.27.2 ZNF701 [7]   UniProt  ProteinAtlas T21008      
  2.3.3.27.3 ZNF765 [11]   UniProt  ProteinAtlas T21038      
  2.3.3.27.4 ZNF468 [11]   UniProt  ProteinAtlas T20640      
  2.3.3.28 Subfamily: ZNF76-like factors CCCATCATGCCTTGC  
  2.3.3.28.1 ZNF76 (ZNF523) [7]   UniProt  ProteinAtlas T04994 UniProt UniProt  
  2.3.3.28.2 ZNF143 (SBF, STAF) [7] UniProt  ProteinAtlas T04993 UniProt UniProt  
  2.3.3.29 Subfamily: ZNF652-like factors    
  2.3.3.29.1 ZNF652 (ZFP652) [9] UniProt  ProteinAtlas T20927 UniProt UniProt  
  2.3.3.29.2 ZBTB47 (ZNF651) [9]   UniProt  ProteinAtlas T20245   UniProtF  
  2.3.3.30 Subfamily: ZNF350-like factors TGGgttCAGactTTG  
  2.3.3.30.1 ZNF350 (ZBRK1) [8]   UniProt  ProteinAtlas T08578      
  2.3.3.30.2 ZNF577 [8]   UniProt  ProteinAtlas T20827      
  2.3.3.30.3 ZNF649 [10]   UniProt  ProteinAtlas T20925      
  2.3.3.30.4 ZNF613 [12]   UniProt  ProteinAtlas T20870      
  2.3.3.30.5 ZNF614 [12]   UniProt  ProteinAtlas T20873      
  2.3.3.31 Subfamily: ZNF642-like factors    
  2.3.3.31.1 ZNF642 (ZFP69) [9]   UniProt  ProteinAtlas T20915      
  2.3.3.31.2 ZNF643 (ZFP69B) [9]   UniProt  ProteinAtlas T20917      
  2.3.3.31.3 ZNF570 [11]   UniProt  ProteinAtlas T20805      
  2.3.3.31.4 ZNF583 [12]   UniProt  ProteinAtlas T20837 UniProt    
  2.3.3.32 Subfamily: ZNF679-like factors    
  2.3.3.32.1 ZNF679 [9]   UniProt  ProteinAtlas T19546      
  2.3.3.32.2 ZNF735 [9]   UniProt   T21356      
  2.3.3.33 Subfamily: ZNF763-like factors    
  2.3.3.33.1 ZNF763 [8]   UniProt  ProteinAtlas T21035      
  2.3.3.33.2 ZNF844 [9]   UniProt  ProteinAtlas T21133      
  2.3.3.33.3 ZNF625 [9]   UniProt  ProteinAtlas T20896      
  2.3.3.33.4 ZNF669 [9]   UniProt  ProteinAtlas T20961      
  2.3.3.33.5 ZNF670 [9]   UniProt  ProteinAtlas T19545      
  2.3.3.33.6 ZNF124 (HZF-16) [8]   UniProt  ProteinAtlas T04991      
  2.3.3.33.7 ZNF627 [11]   UniProt  ProteinAtlas T20901      
  2.3.3.33.8 ZNF439 [11]   UniProt  ProteinAtlas T19493      
  2.3.3.33.9 ZNF440 [12]   UniProt  ProteinAtlas T19495      
  2.3.3.33.10 ZNF77 [12]   UniProt  ProteinAtlas T19575      
  2.3.3.33.11 ZNF490 [13]   UniProt  ProteinAtlas T20660      
  2.3.3.33.12 ZNF563 [12]   UniProt  ProteinAtlas T20791      
  2.3.3.33.13 ZNF57 (ZNF424) [13]   UniProt  ProteinAtlas T21194      
  2.3.3.33.14 ZNF69 [14]   UniProt  ProteinAtlas T21196      
  2.3.3.33.15 ZNF136 [14]   UniProt  ProteinAtlas T19416      
  2.3.3.33.16 ZNF564 [15]   UniProt  ProteinAtlas T21481      
  2.3.3.33.17 ZNF20 (KOX13) [15]   UniProt  ProteinAtlas T04982      
  2.3.3.33.18 ZNF878 [15]   UniProt  ProteinAtlas T23625      
  2.3.3.33.19 ZNF555 [15]   UniProt  ProteinAtlas T20774      
  2.3.3.34 Subfamily: ZNF3-like factors    
  2.3.3.34.1 ZNF3 (KOX25) [8]   UniProt  ProteinAtlas T21179      
  2.3.3.34.2 ZNF397 (ZSCAN15) [9]   UniProt  ProteinAtlas T20574      
  2.3.3.35 Subfamily: ZNF620-like factors    
  2.3.3.35.1 ZNF620 [8]   UniProt  ProteinAtlas T20885      
  2.3.3.35.2 ZNF621 [7]   UniProt  ProteinAtlas T20888      
  2.3.3.35.3 ZNF566 [8]   UniProt  ProteinAtlas T20796      
  2.3.3.35.4 ZNF619 [10]   UniProt  ProteinAtlas T21471      
  2.3.3.35.5 ZNF383 [11]   UniProt  ProteinAtlas T20562      
  2.3.3.35.6 ZNF829 [10]   UniProt  ProteinAtlas T21124      
  2.3.3.35.7 ZNF582 [10]   UniProt  ProteinAtlas T20835      
  2.3.3.36 Subfamily: ZNF324 factors    
  2.3.3.36.1 ZNF324A [9]   UniProt  ProteinAtlas T20189      
  2.3.3.36.2 ZNF324B [9]   UniProt  ProteinAtlas T20191      
  2.3.3.37 Subfamily: ZNF362-like factors    
  2.3.3.37.1 ZNF362 [6]   UniProt  ProteinAtlas T20544      
  2.3.3.37.2 ZNF384 (CAGH1, CIZ, NMP4, TNRC1) [8]   UniProt  ProteinAtlas T16375   UniProt  
  2.3.3.38 Subfamily: ZNF282-like factors TCCACCCC  
  2.3.3.38.1 ZNF282 (HUB1) [5] UniProt  ProteinAtlas T20491      
  2.3.3.38.2 ZNF398 (ZER6) [9]   UniProt  ProteinAtlas T14522      
  2.3.3.39 Subfamily: ZNF764-like factors    
  2.3.3.39.1 ZNF764 [7]   UniProt  ProteinAtlas T19558      
  2.3.3.39.2 ZNF785 [7]   UniProt  ProteinAtlas T21083      
  2.3.3.39.3 ZNF771 [8]   UniProt  ProteinAtlas T21049 UniProt    
  2.3.3.40 Subfamily: ZNF177-like factors    
  2.3.3.40.1 ZNF177 [7]   UniProt  ProteinAtlas T20390      
  2.3.3.40.2 ZNF891 [8]   UniProt  ProteinAtlas T24067      
  2.3.3.40.3 ZNF333 [10]   UniProt  ProteinAtlas T15873      
  2.3.3.41 Subfamily: ZNF32-like factors    
  2.3.3.41.1 ZNF32 (KOX30, Zfp637) [7]   UniProt  ProteinAtlas T21175 UniProt UniProt PDB
  2.3.3.41.2 ZIK1 (ZNF762) [9]   UniProt  ProteinAtlas T20331 UniProt    
  2.3.3.42 Subfamily: ZNF773-like factors    
  2.3.3.42.1 ZNF773 (ZNF419B) [9]   UniProt  ProteinAtlas T21056      
  2.3.3.42.2 ZNF419 (ZNF419A) [11]   UniProt  ProteinAtlas T20597      
  2.3.3.43 Subfamily: ZNF558-like factors    
  2.3.3.43.1 ZNF558 [9]   UniProt  ProteinAtlas T20782      
  2.3.3.43.2 ZNF557 [10]   UniProt  ProteinAtlas T20779      
  2.3.3.44 Subfamily: ZNF302-like factors    
  2.3.3.44.1 ZNF302 (ZNF135L, ZNF140L, ZNF327) [7]   UniProt  ProteinAtlas T19458      
  2.3.3.44.2 ZNF2 (ZNF661) [9]   UniProt  ProteinAtlas T21171 UniProt    
  2.3.3.44.3 ZNF181 [11]   UniProt  ProteinAtlas T20394      
  2.3.3.44.4 ZNF140 [10]   UniProt  ProteinAtlas T20374      
  2.3.3.45 Subfamily: ZNF562-like factors    
  2.3.3.45.1 ZNF562 [8]   UniProt  ProteinAtlas T20788      
  2.3.3.45.3 ZNF561 [12]   UniProt  ProteinAtlas T20786      
  2.3.3.45.4 ZNF559 [13]   UniProt  ProteinAtlas T19521      
  2.3.3.45.5 ZNF846 [14]   UniProt  ProteinAtlas T21389      
  2.3.3.46 Subfamily: ZXD-factors    
  2.3.3.46.1 ZXDA [10]   UniProt  ProteinAtlas T23628      
  2.3.3.46.2 ZXDB [10]   UniProt  ProteinAtlas T23630 UniProt    
  2.3.3.46.3 ZXDC (ZXDL) [10]   UniProt  ProteinAtlas T22485 UniProt UniProt  
  2.3.3.47 Subfamily: ZNF222-like factors    
  2.3.3.47.1 ZNF222 [10]   UniProt  ProteinAtlas T20435      
  2.3.3.47.2 ZNF223 [10]   UniProt  ProteinAtlas T21520      
  2.3.3.47.3 ZNF230 (FDZF2) [10]   UniProt  ProteinAtlas T20445      
  2.3.3.47.4 ZNF155 [12]   UniProt  ProteinAtlas T20380      
  2.3.3.47.5 ZNF221 [15]   UniProt  ProteinAtlas T20433      
  2.3.3.47.6 ZNF224 (BMZF2, KOX22, ZNF233, ZNF255, ZNF27) [18]   UniProt  ProteinAtlas T18478     PDB
  2.3.3.47.7 ZNF225 [18]   UniProt  ProteinAtlas T20437      
  2.3.3.47.8 ZNF284 (ZNF284L) [15]   UniProt  ProteinAtlas T20495      
  2.3.3.47.9 ZNF235 (ZFP93, ZNF270) [16]   UniProt  ProteinAtlas T20451      
  2.3.3.47.10 ZNF45 (KOX5, ZNF13) [18]   UniProt  ProteinAtlas T04988      
  2.3.3.47.11 ZNF229 [18]   UniProt  ProteinAtlas T20443      
  2.3.3.47.12 ZNF227 [19]   UniProt  ProteinAtlas T20441      
  2.3.3.47.13 ZNF226 [19]   UniProt  ProteinAtlas T20439      
  2.3.3.47.14 ZNF234 (ZNF269) [19]   UniProt  ProteinAtlas T20449      
  2.3.3.48 Subfamily: ZNF736-like factors    
  2.3.3.48.1 ZNF736 [10]   UniProt  ProteinAtlas T23632      
  2.3.3.48.2 ZNF727 [11]   UniProt  ProteinAtlas T23634      
  2.3.3.49 Subfamily: ZNF286 factors    
  2.3.3.49.1 ZNF286A [10]   UniProt  ProteinAtlas T20181      
  2.3.3.49.2 ZNF286B (ZNF286C, ZNF286L) [10]   UniProt  ProteinAtlas        
  2.3.3.50 Subfamily: CTCF-like factors    
  2.3.3.50.1 CTCF [11] UniProt  ProteinAtlas T02284 UniProt UniProt PDB
  2.3.3.50.2 CTCFL (CTCF-T, BORIS) [11]   UniProt  ProteinAtlas T23638 UniProt UniProt  
  2.3.3.51 Subfamily: ZNF366-like factors    
  2.3.3.51.1 ZNF366 [11]   UniProt  ProteinAtlas T20546      
  2.3.3.51.2 ZNF710 [11]   UniProt  ProteinAtlas T21012 UniProt    
  2.3.3.52 Subfamily: ZNF322-like factors    
  2.3.3.52.1 ZNF322A (ZNF322, ZNF388, ZNF489, ZFP322A) [11]   UniProt  ProteinAtlas T20183 UniProt UniProt  
  2.3.3.53 Subfamily: ZNF548-like factors    
  2.3.3.53.1 ZNF548 [11]   UniProt  ProteinAtlas T20757      
  2.3.3.53.2 ZNF776 [11]   UniProt  ProteinAtlas T21065      
  2.3.3.54 Subfamily: ZNF460-like factors    
  2.3.3.54.1 ZNF460 (ZNF272) [11]   UniProt  ProteinAtlas T20635      
  2.3.3.54.2 ZNF264 [13]   UniProt  ProteinAtlas T20478      
  2.3.3.54.3 ZNF805 [13]   UniProt  ProteinAtlas T21411      
  2.3.3.54.4 ZNF543 [13]   UniProt  ProteinAtlas T20748      
  2.3.3.54.5 ZNF599 [14]   UniProt  ProteinAtlas T20857      
  2.3.3.55 Subfamily: ZNF146-like factors    
  2.3.3.55.1 ZNF146 [10]   UniProt  ProteinAtlas T02323 UniProt    
  2.3.3.55.2 ZNF260 (ZFP260) [13]   UniProt  ProteinAtlas T20474 UniProt UniProt  
  2.3.3.56 Subfamily: ZNF214-like factors    
  2.3.3.56.1 ZNF214 (BAZ1) [11]   UniProt  ProteinAtlas T20429      
  2.3.3.56.2 ZNF285 (ZNF285A) [11]   UniProt  ProteinAtlas T23641      
  2.3.3.56.3 ZNF233 [12]   UniProt  ProteinAtlas T20447      
  2.3.3.57 Subfamily: ZNF479-like factors    
  2.3.3.57.1 ZNF479 [12]   UniProt  ProteinAtlas T20648      
  2.3.3.57.2 ZNF716 [12]   UniProt  ProteinAtlas T24077      
  2.3.3.58 Subfamily: ZNF180-like factors    
  2.3.3.58.1 ZNF180 [12]   UniProt  ProteinAtlas T20392      
  2.3.3.58.2 ZNF544 [13]   UniProt  ProteinAtlas T20750      
  2.3.3.58.3 ZNF436 (Zfp46) [12]   UniProt  ProteinAtlas T20613 UniProt UniProt  
  2.3.3.58.4 ZNF572 [12]   UniProt  ProteinAtlas T20809      
  2.3.3.58.5 ZNF774 [12]   UniProt  ProteinAtlas T21059      
  2.3.3.58.6 ZSCAN2 (ZFP29, ZNF854) [14]   UniProt  ProteinAtlas T21245 UniProt UniProt  
  2.3.3.59 Subfamily: ZNF100-like factors    
  2.3.3.59.1 ZNF100 [12]   UniProt  ProteinAtlas T20353      
  2.3.3.59.2 ZNF430 [12]   UniProt  ProteinAtlas T20604      
  2.3.3.59.3 ZNF431 [13]   UniProt  ProteinAtlas T20606 UniProt    
  2.3.3.59.4 ZNF730 [12]   UniProt  ProteinAtlas T21437      
  2.3.3.59.5 ZNF714 [14]   UniProt  ProteinAtlas T21023      
  2.3.3.59.6 ZNF675 (TIZ) [15]   UniProt  ProteinAtlas T20970      
  2.3.3.60 Subfamily: ZNF98-like factors    
  2.3.3.60.1 ZNF98 (ZNF739) [13]   UniProt  ProteinAtlas T23644      
  2.3.3.60.2 ZNF492 (ZNF115) [13]   UniProt  ProteinAtlas T20664      
  2.3.3.61 Subfamily: ZNF343-like factors    
  2.3.3.61.1 ZNF343 [12]   UniProt  ProteinAtlas T20534      
  2.3.3.61.2 HKR1 (ZNF875) [13]   UniProt  ProteinAtlas T19986      
  2.3.3.61.3 ZNF169 [13]   UniProt  ProteinAtlas T20386      
  2.3.3.61.4 ZNF133 (ZNF150) [15]   UniProt  ProteinAtlas T04992      
  2.3.3.62 Subfamily: ZFP2-like factors    
  2.3.3.62.1 ZFP2 (ZNF751) [13]   UniProt  ProteinAtlas T20288 UniProt UniProt  
  2.3.3.62.2 ZNF71 (EZFIT) [13]   UniProt  ProteinAtlas T21201      
  2.3.3.62.3 ZNF568 [15]   UniProt  ProteinAtlas T20798      
  2.3.3.63 Subfamily: ZFP30-like factors    
  2.3.3.63.1 ZFP30 (ZNF745) [13]   UniProt  ProteinAtlas T20290 UniProt    
  2.3.3.63.2 ZFP82 (ZNF545) [13]   UniProt  ProteinAtlas T20311 UniProt    
  2.3.3.63.3 ZFP14 (ZNF531) [13]   UniProt  ProteinAtlas T20275 UniProt UniProt  
  2.3.3.64 Subfamily: ZNF354A-like factors    
  2.3.3.64.1 ZNF354A (EZNF, HKL1, TCF17) [13]   UniProt  ProteinAtlas T04965 UniProt UniProt  
  2.3.3.64.2 ZNF354B [13]   UniProt  ProteinAtlas T20194 UniProt UniProt  
  2.3.3.65 Subfamily: ZFX/ZFY factors AGGCCC  
  2.3.3.65.1 ZFX [13]   UniProt  ProteinAtlas T02367 UniProt UniProt  
  2.3.3.65.2 ZFY [13]   UniProt  ProteinAtlas T04967 UniProt
UniProt
  PDB
  2.3.3.66 Subfamily: ZNF689-like factors    
  2.3.3.66.1 ZNF689 [12]   UniProt  ProteinAtlas T20994 UniProt UniProt  
  2.3.3.66.2 ZNF672 [14]   UniProt  ProteinAtlas T20965 UniProt UniProt  
  2.3.3.67 Subfamily: ZFN283-like factors    
  2.3.3.67.1 ZNF283 (HZF19) [15]   UniProt  ProteinAtlas T20493      
  2.3.3.67.2 ZNF345 (HZF10) [15]   UniProt  ProteinAtlas T20538      
  2.3.3.67.3 ZNF404 [15]   UniProt  ProteinAtlas T20578      
  2.3.3.67.4 ZNF540 [17]   UniProt  ProteinAtlas T19519      
  2.3.3.67.5 ZNF571 [17]   UniProt  ProteinAtlas T20807      
  2.3.3.67.6 ZNF30 (KOX28) [18]   UniProt  ProteinAtlas T21362      
  2.3.3.67.7 ZNF420 [19]   UniProt  ProteinAtlas T19483      
  2.3.3.67.8 ZNF573 [19]   UniProt  ProteinAtlas T20811      
  2.3.3.67.9 ZNF607 [20]   UniProt  ProteinAtlas T19537      
  2.3.3.67.10 ZNF546 (ZNF49) [22]   UniProt  ProteinAtlas T20752      
  2.3.3.67.11 ZNF780A [17]   UniProt  ProteinAtlas T20207      
  2.3.3.67.12 ZNF780B (ZNF779) [23]   UniProt  ProteinAtlas T20210      
  2.3.3.68 Subfamily: ZFN81-like factors    
  2.3.3.68.1 ZNF81 (KOX32) [12]   UniProt  ProteinAtlas T21207      
  2.3.3.68.2 ZNF175 [15]   UniProt  ProteinAtlas T20388      
  2.3.3.68.3 ZNF41 [18]   UniProt  ProteinAtlas T21181      
  2.3.3.68.4 ZNF484 [19]   UniProt  ProteinAtlas T20652     PDB
  2.3.3.68.5 ZNF585B [21]   UniProt  ProteinAtlas T22513      
  2.3.3.68.6 ZNF585A [22]   UniProt  ProteinAtlas T23652      
  2.3.3.69 Subfamily: ZFN25-like factors    
  2.3.3.69.1 ZNF25 (KOX19) [12]   UniProt  ProteinAtlas T21163      
  2.3.3.69.2 ZNF157 [12]   UniProt  ProteinAtlas T20382      
  2.3.3.69.3 ZFP37 [12]   UniProt  ProteinAtlas T04977 UniProt UniProt  
  2.3.3.69.4 ZNF567 [15]   UniProt  ProteinAtlas T19523      
  2.3.3.69.5 ZNF782 [15]   UniProt  ProteinAtlas T21077      
  2.3.3.69.6 ZNF33A (KOX31, ZNF11, ZNF11A, ZNF33) [16]   UniProt  ProteinAtlas T04984      
  2.3.3.69.7 ZNF33B (KOX2, ZNF11B) [16]   UniProt  ProteinAtlas T19469      
  2.3.3.70 Subfamily: ZFN26-like factors    
  2.3.3.70.1 ZNF26 (KOX20) [13]   UniProt  ProteinAtlas T21166      
  2.3.3.70.2 ZNF268 [24]   UniProt  ProteinAtlas T20482      
  2.3.3.71 Subfamily: ZFN300-like factors    
  2.3.3.71.1 ZNF300 [12]   UniProt  ProteinAtlas T20506      
  2.3.3.71.2 ZNF605 [17]   UniProt  ProteinAtlas T21457      
  2.3.3.72 Subfamily: ZFN813-like factors    
  2.3.3.72.1 ZNF813 [14]   UniProt  ProteinAtlas T21439      
  2.3.3.72.2 ZNF860 [14]   UniProt  ProteinAtlas T21137      
  2.3.3.72.3 ZNF611 [17]   UniProt  ProteinAtlas T20867      
  2.3.3.72.4 ZNF600 [20]   UniProt  ProteinAtlas T20860      
  2.3.3.72.5 ZNF808 [24]   UniProt  ProteinAtlas T21112      
  2.3.3.72.6 ZNF761 [19]   UniProt  ProteinAtlas T21031      
  2.3.3.72.7 ZNF845 [27]   UniProt  ProteinAtlas T21135      
  2.3.3.73 Subfamily: ZNF816A-like factors    
  2.3.3.73.1 ZNF816A [15]   UniProt  ProteinAtlas T20212      
  2.3.3.73.2 ZNF28 (KOX24) [18]   UniProt  ProteinAtlas T21168      
  2.3.3.74 Subfamily: ZNF442-like factors    
  2.3.3.74.1 ZNF442 [16]   UniProt  ProteinAtlas T20623      
  2.3.3.74.2 ZNF823 (ZFP36) [16]   UniProt  ProteinAtlas T21115      
  2.3.3.74.3 ZNF44 (GIOT2, KOX7, ZNF55, ZNF58) [17]   UniProt  ProteinAtlas T04987      
  2.3.3.74.4 ZNF799 (ZNF842) [18]   UniProt  ProteinAtlas T21105      
  2.3.3.74.5 ZNF443 [19]   UniProt  ProteinAtlas T19496      
  2.3.3.75 Subfamily: ZNF432-like factors    
  2.3.3.75.1 ZNF432 [16]   UniProt  ProteinAtlas T20608      
  2.3.3.75.2 ZNF615 [19]   UniProt  ProteinAtlas T20875      
  2.3.3.76 Subfamily: ZNF665-like factors    
  2.3.3.76.1 ZNF665 (ZFP160L) [18]   UniProt  ProteinAtlas T21500      
  2.3.3.76.2 ZNF160 [20]   UniProt  ProteinAtlas T20384      
  2.3.3.76.3 ZNF347 (ZNF1111) [20]   UniProt  ProteinAtlas T20540     PDB
  2.3.3.77 Subfamily: ZNF595-like factors    
  2.3.3.77.1 ZNF595 [18]   UniProt  ProteinAtlas T21462      
  2.3.3.77.2 ZNF721 [30]   UniProt  ProteinAtlas T21483      
  2.3.3.78 Subfamily: ZNF14-like factors    
  2.3.3.78.1 ZNF14 (GIOT4, KOX6) [19]   UniProt  ProteinAtlas T21139      
  2.3.3.78.2 ZNF709 [19]   UniProt  ProteinAtlas T21010      
  2.3.3.79 Subfamily: ZNF841-like factors    
  2.3.3.79.1 ZNF841 [23]   UniProt  ProteinAtlas T21443      
  2.3.3.79.2 ZNF836 [25]   UniProt  ProteinAtlas T21129      
  2.3.3.79.3 ZNF616 [21]   UniProt  ProteinAtlas T20879      
  2.3.3.80 Subfamily: ZNF99-like factors    
  2.3.3.80.1 ZNF99 [30]   UniProt  ProteinAtlas T21221      
  2.3.3.80.2 ZNF729 [35]   UniProt  ProteinAtlas T24073      
  2.3.3.81 Subfamily: ZNF12-like factors    
  2.3.3.81.1 ZNF12 (GIOT3, KOX3, ZNF325) [15]   UniProt  ProteinAtlas T09452 UniProt    
  2.3.3.81.2 RBAK (ZNF769) [16]   UniProt  ProteinAtlas T22451 UniProt UniProt  
  2.3.3.0 Subfamily: unclassified    
  2.3.3.0.1 ZFP161 (ZBTB14, ZNF478) CTACCTGCACAGTTCACGGA UniProt  ProteinAtlas T16570 UniProt UniProt  
  2.3.3.0.3 ZNF496 (ZKSCAN17, Zfp496)   UniProt  ProteinAtlas T19516 UniProt UniProt  
  2.3.3.0.6 ZNF274 (neurotrophin receptor-interacting factor homolog; ZKSCAN19)   UniProt  ProteinAtlas T19451      
  2.3.3.0.7 ZNF200 (ZNFMF)   UniProt  ProteinAtlas T23661      
  2.3.3.0.9 OSR2   UniProt  ProteinAtlas T23664 UniProt UniProt  
  2.3.3.0.10 ZNF781   UniProt  ProteinAtlas T21074      
  2.3.3.0.11 ZNF114   UniProt  ProteinAtlas T20357      
  2.3.3.0.12 ZNF589 (SZF1) GGGtaaCAG UniProt  ProteinAtlas T08668      
  2.3.3.0.13 ZNF22 (KOX15, KROX26,Zfp422) CAATG UniProt  ProteinAtlas T21155 UniProt UniProt  
  2.3.3.0.14 ZNF713 UniProt  ProteinAtlas T21021      
  2.3.3.0.15 ZSCAN16 (ZNF392, ZNF435) UniProt  ProteinAtlas T19581     PDB
  2.3.3.0.16 ZNF793   UniProt  ProteinAtlas T21102      
  2.3.3.0.17 ZFP41   UniProt  ProteinAtlas T20300 UniProt UniProt  
  2.3.3.0.18 ZNF215 (BAZ2, ZKSCAN11)   UniProt  ProteinAtlas T20431      
  2.3.3.0.20 ZNF18 (KOX11, ZKSCAN6, ZNF535, Zfp18, Zfp535)   UniProt  ProteinAtlas T21147 UniProt UniProt  
  2.3.3.0.21 WT1 CGCCCCCGC UniProt  ProteinAtlas T10292 UniProt UniProt PDB
  2.3.3.0.22 ZNF137P (ZNF137)   UniProt   HumanPSD      
  2.3.3.0.23 PRDM6 (PFM3)   UniProt  ProteinAtlas T23670 UniProt UniProt  
  2.3.3.0.24 ZNF444 (EZF2, ZSCAN17, Zfp444)   UniProt  ProteinAtlas T05160 UniProt UniProt  
  2.3.3.0.25 ZNF641 (Zfp641)   UniProt  ProteinAtlas T20909 UniProt UniProt  
  2.3.3.0.26 ZNF746 (PARIS, Zfp746) TATTTTT UniProt  ProteinAtlas T23674 UniProt UniProt  
  2.3.3.0.27 ZIM2 (ZNF656)   UniProt  ProteinAtlas T20337      
  2.3.3.0.28 ZBTB44 (BTBD15, ZNF851)   UniProt  ProteinAtlas T19388 UniProt UniProt  
  2.3.3.0.30 ZNF576   UniProt  ProteinAtlas T20825      
  2.3.3.0.31 ZNF655 (VIK) [6]   UniProt  ProteinAtlas T19543 UniProt UniProt  
  2.3.3.0.32 ZNF165 (ZPF165, ZSCAN7) [6]   UniProt  ProteinAtlas T19422      
  2.3.3.0.34 ZNF131 (Zfp131) [6]   UniProt  ProteinAtlas T20365 UniProt UniProt  
  2.3.3.0.35 PRDM14 [6] GGTCTCTAA UniProt  ProteinAtlas T20071 UniProt    
  2.3.3.0.37 ZNF575 (Zfp575) [6]   UniProt  ProteinAtlas T20821 UniProt UniProt  
  2.3.3.0.38 ZBTB49 [7] UniProt  ProteinAtlas T23682 UniProt UniProt  
  2.3.3.0.39 ZNF691 (Zfp691) [7]   UniProt  ProteinAtlas T23685 UniProt UniProt  
  2.3.3.0.40 ZNF394 (ZKSCAN14, Zfp94, Zfp99) [7]   UniProt  ProteinAtlas T20566 UniProt UniProt  
  2.3.3.0.41 ZNF449 (ZSCAN19, Zfp449) [7]   UniProt  ProteinAtlas T20629 UniProt UniProt  
  2.3.3.0.42 ZNF498 (ZSCAN25, Zfp498) [7]   UniProt  ProteinAtlas T20671 UniProt UniProt  
  2.3.3.0.43 ZSCAN30 (ZNF397OS) [7]   UniProt  ProteinAtlas T23688 UniProt UniProt  
  2.3.3.0.45 ZNF80 [7]   UniProt  ProteinAtlas T21205      
  2.3.3.0.46 ZNF514 [7]   UniProt  ProteinAtlas T20707      
  2.3.3.0.47 ZSCAN21 (ZFP38, ZNF38) [7]   UniProt  ProteinAtlas T19585 UniProt    
  2.3.3.0.51 ZNF707 [7]   UniProt  ProteinAtlas T19556      
  2.3.3.0.54 MYNN (OSZF, ZBTB31) [8]   UniProt  ProteinAtlas T20028 UniProt UniProt  
  2.3.3.0.55 ZBTB24 (ZNF450) [8]   UniProt  ProteinAtlas T19378 UniProt UniProt  
  2.3.3.0.57 ZFP92 [8]   UniProt   T20323 UniProt UniProt  
  2.3.3.0.58 ZNF205 (ZNF210) [8]   UniProt  ProteinAtlas T19432      
  2.3.3.0.59 ZNF837 [8]   UniProt  ProteinAtlas T21131      
  2.3.3.0.60 ZNF202 (ZKSCAN10, Zfp202) [8] GGGGTGGGGT UniProt  ProteinAtlas T19429 UniProt UniProt  
  2.3.3.0.61 ZNF789 [8]   UniProt  ProteinAtlas T21092      
  2.3.3.0.62 ZNF662 [8]   UniProt  ProteinAtlas T20946      
  2.3.3.0.63 ZNF554 [8]   UniProt  ProteinAtlas T20772      
  2.3.3.0.64 ZNF506 [8]   UniProt  ProteinAtlas T20683      
  2.3.3.0.65 ZNF66 [8]   UniProt  ProteinAtlas T21441      
  2.3.3.0.67 ZNF584 [8]   UniProt  ProteinAtlas T20841      
  2.3.3.0.68 ZNF684 [8]   UniProt  ProteinAtlas T20986      
  2.3.3.0.69 ZNF187 (ZSCAN26, SRE-ZBP) [8]   UniProt   T02321 UniProt UniProt  
  2.3.3.0.70 ZSCAN22 (HKR2, ZNF50) [8]   UniProt  ProteinAtlas T21233 UniProt UniProt  
  2.3.3.0.71 ZNF550 [8]   UniProt  ProteinAtlas T20763      
  2.3.3.0.72 ZFP1 (ZNF475) [8]   UniProt  ProteinAtlas T20277 UniProt UniProt  
  2.3.3.0.73 ZNF73 (ZNF186) [8]   UniProt   T24075      
  2.3.3.0.74 ZBTB16 (PLZF, ZNF145) [9] TAAAGTTTGATCTGTTC UniProt  ProteinAtlas T02336 UniProt UniProt  
  2.3.3.0.75 GTF3A (TFIIIA) [9]   UniProt  ProteinAtlas T04953 UniProt UniProt PDB
  2.3.3.0.76 ZFP64 [9]   UniProt  ProteinAtlas T19402 UniProt UniProt PDB
  2.3.3.0.77 ZNF358 [9]   UniProt  ProteinAtlas T20542 UniProt UniProt  
  2.3.3.0.78 ZNF696 [9]   UniProt  ProteinAtlas T20998      
  2.3.3.0.79 ZNF263 (FPM315, ZKSCAN12, Zfp263) [9] GGGAGGAGG UniProt  ProteinAtlas T16092 UniProt UniProt  
  2.3.3.0.80 ZNF556 [9]   UniProt  ProteinAtlas T20777      
  2.3.3.0.81 ZNF192 (ZKSCAN8, LD5-1) [9]   UniProt  ProteinAtlas T19425 UniProt UniProt  
  2.3.3.0.82 ZNF391 [9]   UniProt  ProteinAtlas T20564      
  2.3.3.0.83 ZNF239 (HOK-2, MOK-2, Zfp239) [9]   UniProt  ProteinAtlas T10702 UniProt UniProt  
  2.3.3.0.84 ZNF664 (ZFOC1, ZNF196, Zfp664) [9]   UniProt  ProteinAtlas T20949 UniProt UniProt  
  2.3.3.0.87 ZNF501 (ZNF52) [9]   UniProt  ProteinAtlas T20678      
  2.3.3.0.89 ZNF610 [9]   UniProt  ProteinAtlas T20864      
  2.3.3.0.91 ZNF660 [10]   UniProt  ProteinAtlas T20944      
  2.3.3.0.92 GZF1 (ZBTB23, ZNF336) [10] TGCGCGTCTATA UniProt  ProteinAtlas T08232 UniProt UniProt  
  2.3.3.0.93 ZNF408 (PFM14, PRDM17, Zfp408) [10]   UniProt  ProteinAtlas T19474 UniProt    
  2.3.3.0.94 ZNF648 (Zfp648) [10]   UniProt  ProteinAtlas T20923 UniProt UniProt  
  2.3.3.0.95 ZNF768 (Zfp768) [10]   UniProt  ProteinAtlas T19559 UniProt UniProt  
  2.3.3.0.96 ZNF517 [10]   UniProt  ProteinAtlas T20713      
  2.3.3.0.97 ZNF547 [10]   UniProt  ProteinAtlas T20754      
  2.3.3.0.98 ZNF766 [10]   UniProt  ProteinAtlas T21041      
  2.3.3.0.99 ZNF677 [10]   UniProt  ProteinAtlas T20974      
  2.3.3.0.100 ZNF35 [11]   UniProt  ProteinAtlas T04985      
  2.3.3.0.101 ZNF483 (ZKSCAN16) [11]   UniProt  ProteinAtlas T20650 UniProt    
  2.3.3.0.102 ZBTB48 (HKR3, ZNF855) [11]   UniProt  ProteinAtlas T04971 UniProt UniProt PDB
  2.3.3.0.103 ZNF275 (Zfp275) [11]   UniProt  ProteinAtlas T21512 UniProt UniProt  
  2.3.3.0.104 ZIM3 (ZNF657) [11]   UniProt  ProteinAtlas T20339      
  2.3.3.0.106 ZNF596 (ZNF272) [11]   UniProt  ProteinAtlas T20851 UniProt    
  2.3.3.0.107 ZNF253 (BMZF1, ZNF411) [11]   UniProt  ProteinAtlas T20463      
  2.3.3.0.108 ZNF355P (ZnFP01, ZNF834) [11]   UniProt   T21514      
  2.3.3.0.109 ZNF682 [11]   UniProt  ProteinAtlas T20980      
  2.3.3.0.110 ZNF141 (D4S90) [11]   UniProt  ProteinAtlas T20376      
  2.3.3.0.111 ZNF718 [11]   UniProt  ProteinAtlas T21402      
  2.3.3.0.112 ZNF121 (ZNF20) [11]   UniProt  ProteinAtlas T20363      
  2.3.3.0.113 ZNF485 [11]   UniProt  ProteinAtlas T20654      
  2.3.3.0.114 ZNF354C (KID3) [11] CCACC UniProt  ProteinAtlas T09609 UniProt UniProt  
  2.3.3.0.115 ZNF586 [11]   UniProt  ProteinAtlas T20843      
  2.3.3.0.118 ZNF10 (KOX1) [11]   UniProt  ProteinAtlas T02283      
  2.3.3.0.119 ZNF19 (KOX12) [10]   UniProt  ProteinAtlas T21152      
  2.3.3.0.120 ZSCAN12 (ZNF305, ZNF96) [11]   UniProt  ProteinAtlas T19579 UniProt UniProt  
  2.3.3.0.121 ZNF70 (N27C7-1) [11]   UniProt  ProteinAtlas T21199    
  2.3.3.0.122 ZNF79 [11]   UniProt  ProteinAtlas T21203      
  2.3.3.0.123 ZBTB40 [12]   UniProt  ProteinAtlas T20237 UniProt UniProt  
  2.3.3.0.124 ZBTB11 [12]   UniProt  ProteinAtlas T20214   UniProt  
  2.3.3.0.125 ZNF454 (Zfp454) [12]   UniProt  ProteinAtlas T20633 UniProt UniProt  
  2.3.3.0.126 ZNF154 [12]   UniProt  ProteinAtlas T20378      
  2.3.3.0.127 ZNF416 [12]   UniProt  ProteinAtlas T20593      
  2.3.3.0.130 ZNF34 (KOX32) [12]   UniProt  ProteinAtlas T21177      
  2.3.3.0.132 ZNF74 (ZNF520) [12]   UniProt  ProteinAtlas T19567      
  2.3.3.0.133 ZNF415 [12]   UniProt  ProteinAtlas T20587      
  2.3.3.0.134 ZNF480 [12]   UniProt  ProteinAtlas T23695      
  2.3.3.0.135 ZNF578 [12]   UniProt  ProteinAtlas T20829      
  2.3.3.0.136 ZNF320 [12]   UniProt  ProteinAtlas T20518      
  2.3.3.0.137 ZNF626 [12]   UniProt  ProteinAtlas T20898      
  2.3.3.0.139 ZNF257 (BMZF4) [13]   UniProt  ProteinAtlas T20472      
  2.3.3.0.140 ZNF680 [12]   UniProt  ProteinAtlas T20976      
  2.3.3.0.142 ZNF331 (RITA, ZNF361, ZNF463) [12]   UniProt  ProteinAtlas T20526      
  2.3.3.0.143 ZNF461 (GIOT1) [12]   UniProt  ProteinAtlas T20637      
  2.3.3.0.144 ZNF527 [12]   UniProt  ProteinAtlas T21477      
  2.3.3.0.145 ZNF529 [12]   UniProt  ProteinAtlas T20734      
  2.3.3.0.146 ZNF565 [12]   UniProt  ProteinAtlas T20794      
  2.3.3.0.148 ZNF329 (Zfp329) [12]   UniProt  ProteinAtlas T20522 UniProt UniProt  
  2.3.3.0.149 ZFP90 (ZNF756) [13]   UniProt  ProteinAtlas T20316 UniProt UniProt  
  2.3.3.0.150 ZNF317 [13]   UniProt  ProteinAtlas T19463 UniProt UniProt  
  2.3.3.0.152 MZF1 (ZNF42, ZSCAN6) [13] AGTGGGGA UniProt  ProteinAtlas T09481 UniProt UniProt  
  2.3.3.0.153 ZNF530 [13]   UniProt  ProteinAtlas T20737      
  2.3.3.0.154 ZNF737 (ZNF102) [13]   UniProt  ProteinAtlas T27281      
  2.3.3.0.155 ZNF273 [13]   UniProt  ProteinAtlas T20485      
  2.3.3.0.156 ZNF695 [13]   UniProt  ProteinAtlas T23703      
  2.3.3.0.157 ZNF879 (Zfp879) [13]   UniProt  ProteinAtlas HumanPSD UniProt UniProt  
  2.3.3.0.158 ZNF790 [13]   UniProt  ProteinAtlas T21095      
  2.3.3.0.159 ZNF167 (ZKSCAN7, ZNF448, ZNF64, Zfp167) [13]   UniProt  ProteinAtlas T19424 UniProt UniProt  
  2.3.3.0.160 ZNF250 (ZNF647, Zfp647) [13]   UniProt  ProteinAtlas T19441 UniProt UniProt  
  2.3.3.0.161 ZNF623 [13]   UniProt  ProteinAtlas T20891      
  2.3.3.0.162 ZFP3 (ZNF752) [13]   UniProt  ProteinAtlas T20296 UniProt UniProt  
  2.3.3.0.163 ZNF883 [13]   UniProt   T23711      
  2.3.3.0.164 ZNF117 (HPF9) [13]   UniProt  ProteinAtlas T20360      
  2.3.3.0.165 ZNF266 [14]   UniProt  ProteinAtlas T20480      
  2.3.3.0.166 ZNF311 (ZFP31) [14]   UniProt  ProteinAtlas T20512 UniProt    
  2.3.3.0.167 ZNF551 (KOX23) [14]   UniProt  ProteinAtlas T20766 UniProt UniProt  
  2.3.3.0.168 ZNF497 [14]   UniProt  ProteinAtlas T20669      
  2.3.3.0.169 ZSCAN10 (ZNF206) [14] GCGCATGCGC UniProt  ProteinAtlas T21227 UniProt UniProt  
  2.3.3.0.173 ZNF880 [14]   UniProt  ProteinAtlas T23713      
  2.3.3.0.174 ZNF287 (ZKSCAN13) [14]   UniProt  ProteinAtlas T20497 UniProt UniProt  
  2.3.3.0.175 ZNF502 [14]   UniProt  ProteinAtlas T20681      
  2.3.3.0.176 ZNF835 [14]   UniProt  ProteinAtlas T21127      
  2.3.3.0.177 ZNF560 [15]   UniProt  ProteinAtlas T20784      
  2.3.3.0.179 ZNF667 [15]   UniProt  ProteinAtlas T20953 UniProt UniProt  
  2.3.3.0.180 ZNF549 [15]   UniProt  ProteinAtlas T20760      
  2.3.3.0.181 ZNF708 (KOX8, ZNF15, ZNF15L1) [15]   UniProt  ProteinAtlas T21360      
  2.3.3.0.182 ZNF254 (BMZF5, ZNF539, ZNF91L) [15]   UniProt  ProteinAtlas T20466      
  2.3.3.0.183 ZNF676 [15]   UniProt  ProteinAtlas T20972      
  2.3.3.0.184 ZNF90 [15]   UniProt  ProteinAtlas T21209      
  2.3.3.0.185 ZNF678 [15]   UniProt  ProteinAtlas T21419      
  2.3.3.0.186 ZNF267 [15]   UniProt  ProteinAtlas T19446      
  2.3.3.0.188 ZNF83 (ZNF816B) [15]   UniProt  ProteinAtlas T04989      
  2.3.3.0.189 ZNF528 [15]   UniProt  ProteinAtlas T20731      
  2.3.3.0.190 ZNF7 (KOX4) [15]   UniProt  ProteinAtlas T09521      
  2.3.3.0.191 ZNF471 (ERP1) [15]   UniProt  ProteinAtlas T19514      
  2.3.3.0.192 ZFP28 [15]   UniProt  ProteinAtlas T20283 UniProt UniProt PDB
  2.3.3.0.193 ZNF182 (KOX14, ZNF21) [15]   UniProt  ProteinAtlas T20397 UniProt UniProt  
  2.3.3.0.194 ZNF732 [16]   UniProt  ProteinAtlas T21346      
  2.3.3.0.195 PRDM5 (PFM2) [16] GGAGAGCAGG UniProt  ProteinAtlas T20080 UniProt UniProt  
  2.3.3.0.197 ZNF189 (Zfp189) [16]   UniProt  ProteinAtlas T20405 UniProt UniProt  
  2.3.3.0.198 ZNF85 (HTF1, HPF4) [16]   UniProt  ProteinAtlas T04990      
  2.3.3.0.199 ZNF92 [16]   UniProt  ProteinAtlas T21213      
  2.3.3.0.200 ZNF681 [16]   UniProt  ProteinAtlas T20978      
  2.3.3.0.201 ZNF724P [16]   UniProt  ProteinAtlas        
  2.3.3.0.202 ZNF135 (ZNF61, ZNF78L1) [16]   UniProt  ProteinAtlas T21378      
  2.3.3.0.203 ZNF699 [16]   UniProt  ProteinAtlas T21004      
  2.3.3.0.204 ZNF16 (KOX9) [17]   UniProt  ProteinAtlas T21141      
  2.3.3.0.205 ZNF17 (HPF3, KOX10) [17]   UniProt  ProteinAtlas T21143      
  2.3.3.0.206 ZNF93 (ZNF505) [17]   UniProt  ProteinAtlas T21217      
  2.3.3.0.207 ZNF534 (KRBO3) [17]   UniProt  ProteinAtlas T23719      
  2.3.3.0.208 ZNF470 (CZF-1) [17]   UniProt  ProteinAtlas T20645      
  2.3.3.0.209 ZNF791 [17]   UniProt  ProteinAtlas T21097      
  2.3.3.0.210 ZNF23 (KOX16, ZNF359, ZNF612, Zfp23, Zfp612) [17]   UniProt  ProteinAtlas T21159   UniProt  
  2.3.3.0.212 ZNF700 [18]   UniProt  ProteinAtlas T21006      
  2.3.3.0.213 ZNF840 (ZNF840P) [18]   UniProt   HumanPSD      
  2.3.3.0.214 ZNF429 [18]   UniProt  ProteinAtlas T20602      
  2.3.3.0.215 ZNF569 [18]   UniProt  ProteinAtlas T20801 UniProt    
  2.3.3.0.216 ZNF84 [19]   UniProt  ProteinAtlas T21376      
  2.3.3.0.217 ZNF749 [19]   UniProt  ProteinAtlas T23722      
  2.3.3.0.218 ZNF425 [19]   UniProt  ProteinAtlas T20600      
  2.3.3.0.220 ZNF184 (Zfp184) [19]   UniProt  ProteinAtlas T20401 UniProt    
  2.3.3.0.221 ZNF441 [19]   UniProt  ProteinAtlas T20621      
  2.3.3.0.224 ZNF433 [19]   UniProt  ProteinAtlas T20610      
  2.3.3.0.225 ZNF337 [20]   UniProt  ProteinAtlas T19468      
  2.3.3.0.226 ZNF726 [20]   UniProt  ProteinAtlas T24051      
  2.3.3.0.227 ZNF624 [21]   UniProt  ProteinAtlas T20893      
  2.3.3.0.228 ZNF197 (ZKSCAN9, ZNF166) [22]   UniProt  ProteinAtlas T20416      
  2.3.3.0.229 ZNF493 [22]   UniProt  ProteinAtlas T20666      
  2.3.3.0.230 ZNF43 (HTF6, KOX27, ZNF39, ZNF39L1) [22]   UniProt  ProteinAtlas T04986      
  2.3.3.0.231 ZFP62 [23]   UniProt  ProteinAtlas T23726 UniProt    
  2.3.3.0.232 ZNF594 (HZF18) [24]   UniProt  ProteinAtlas T20849      
  2.3.3.0.233 ZNF107 (ZFD25, ZNF588) [25]   UniProt  ProteinAtlas T20355      
  2.3.3.0.234 ZNF208 (ZNF91L) [34]   UniProt  ProteinAtlas T24085      
  2.3.3.0.235 ZNF91 (HPF7, HTF10) [36]   UniProt  ProteinAtlas T21211      
  2.3.3.0.237 ZNF852 [12]   UniProt  ProteinAtlas HumanPSD      
  2.3.3.0.238 ZNF728 [14]   UniProt  ProteinAtlas HumanPSD      
  2.3.4 Family: Factors with multiple dispersed zinc fingers    
  2.3.4.1 Subfamily: ZNF417-like factors    
  2.3.4.1.1 ZNF417 [1+12]   UniProt  ProteinAtlas T19481      
  2.3.4.1.2 ZNF587 [1+12]   UniProt  ProteinAtlas T19531      
  2.3.4.1.3 ZNF552 [2+7]   UniProt  ProteinAtlas T28918      
  2.3.4.1.4 ZNF814 [1+22]   UniProt  ProteinAtlas T23730      
  2.3.4.1.5 ZNF418 [1+15]   UniProt  ProteinAtlas T20595      
  2.3.4.1.6 ZNF211 [1+11]   UniProt  ProteinAtlas T20418      
  2.3.4.1.7 ZNF256 (BMZF3) [1+14]   UniProt  ProteinAtlas T20469      
  2.3.4.2 Subfamily: ZNF219-like factors CCCCCA  
  2.3.4.2.1 ZNF219 (Zfp219) [2+1+2+1]   UniProt  ProteinAtlas T08614 UniProt UniProt  
  2.3.4.2.2 ZNF536 (Zfp536) [2+4+1+2]   UniProt  ProteinAtlas T20744 UniProt UniProt  
  2.3.4.2.3 ZNF516 (Zfp516) [2+5+1+1+1]   UniProt  ProteinAtlas T20709 UniProt UniProt  
  2.3.4.2.4 ZNF217 (ZABC1, Zfp217) [1+3+1+2]   UniProt  ProteinAtlas T16738 UniProt UniProt  
  2.3.4.3 Subfamily: Sal-like factors    
  2.3.4.3.1 SALL1 (Spalt-1, Sal-1, ZNF794) [2+3+2+2]   UniProt  ProteinAtlas T19220 UniProt UniProt  
  2.3.4.3.2 SALL2 (Spalt-2, Sal-2, ZNF795) [2+3+2]   UniProt  ProteinAtlas T19223 UniProt UniProt  
  2.3.4.3.3 SALL3 (Sal-3, ZNF796) [2+3+2+2]   UniProt  ProteinAtlas T20094 UniProt UniProt  
  2.3.4.3.4 SALL4 (ZNF797) [2+3+2+2]   UniProt  ProteinAtlas T19227 UniProt UniProt  
  2.3.4.4 Subfamily: Ikaros TTGGGAAT  
  2.3.4.4.1 IKZF1 (IK1, IKAROS, Lyf-1, ZNFN1A1) [4+2]   UniProt  ProteinAtlas T02702 UniProt UniProt  
  2.3.4.4.2 IKZF2 (HELIOS, ZNFN1A2) [4+2]   UniProt  ProteinAtlas T04954 UniProt UniProt  
  2.3.4.4.3 IKZF3 (Aiolos, ZNFN1A3) [4+2]   UniProt  ProteinAtlas T05980 UniProt UniProt  
  2.3.4.4.4 IKZF4 (EOS, ZNFN1A4) [4+2]   UniProt  ProteinAtlas T19015 UniProt UniProt  
  2.3.4.4.5 IKZF5 (Pegasus, ZNFN1A5) [3+2]   UniProt  ProteinAtlas T19019 UniProt UniProt  
  2.3.4.5 Subfamily: HIV EP-factors GGGACTTTCC  
  2.3.4.5.1 HIV-EP1 (ZNF40, PRDII-BF1, MBP-1, CIRIP, GAAP) [2+1+2]   UniProt  ProteinAtlas T14648 UniProt UniProtF  
  2.3.4.5.2 HIV-EP2 (MBP-2, ZNF40B) [2+2]   UniProt  ProteinAtlas T00939 UniProt UniProt  
  2.3.4.5.3 HIV-EP3 (KBP1, KRC, ZAS3) [2+1+2]   UniProt  ProteinAtlas T00441 UniProt UniProt  
  2.3.4.6 Subfamily: ZBTB1-like factors    
  2.3.4.6.1 ZBTB1 [1+1+6]   UniProt  ProteinAtlas T20250 UniProt UniProt  
  2.3.4.6.2 ZBTB2 (ZNF437) [1+3]   UniProt  ProteinAtlas T16107 UniProt UniProt  
  2.3.4.6.3 ZBTB25 (KUP, ZNF46) [1+1]   UniProt  ProteinAtlas T00457 UniProt UniProt  
  2.3.4.7 Subfamily: RLF-like factors    
  2.3.4.7.1 RLF [1+5+1+2+4+1]   UniProt  ProteinAtlas T19212 UniProtF    
  2.3.4.7.2 ZNF292 (Zfp292) [1+5+1+1+2+4+1]   UniProt  ProteinAtlas T20499 UniProt UniProt PDB
  2.3.4.7.3 ZNF654 [1+4]   UniProt  ProteinAtlas T20937 UniProt UniProt  
  2.3.4.8 Subfamily: MAZ-like factors GGGGAGGG  
  2.3.4.8.1 MAZ (Zif87, ZNF801, Pur-1, SAF) [1+5]   UniProt  ProteinAtlas T10433 UniProt UniProt  
  2.3.4.8.2 VEZF1 (DB1, ZNF161) [1+5]   UniProt  ProteinAtlas T02365 UniProt UniProt  
  2.3.4.8.3 PATZ1 (RIAZ, ZBTB19, ZNF278, ZSG) [1+5+1]   UniProt  ProteinAtlas T04797 UniProt UniProt PDB
  2.3.4.9 Subfamily: ZNF532-like factors    
  2.3.4.9.1 ZNF532 (Zfp532) [1+6+3+2]   UniProt  ProteinAtlas T20739 UniProt UniProt  
  2.3.4.9.2 ZNF592 (Zfp592) [2+6+3+2]   UniProt  ProteinAtlas T19533 UniProt UniProt  
  2.3.4.9.3 ZNF687 (Zfp682) [1+5+2+2]   UniProt  ProteinAtlas T19549 UniProt UniProt  
  2.3.4.10 Subfamily: ZNF512-factors    
  2.3.4.10.1 ZNF512 (Zfp512) [1+1+2]   UniProt  ProteinAtlas T20695 UniProt UniProt PDB
  2.3.4.10.2 ZNF512B (Zfp512b) [2+3+2]   UniProt  ProteinAtlas T19366 UniProtF UniProt  
  2.3.4.11 Subfamily: ZNF658-factors    
  2.3.4.11.1 ZNF658 [5+19]   UniProt  ProteinAtlas T20941      
  2.3.4.11.2 ZNF658B [2+19]   UniProt   T19367      
  2.3.4.12 Subfamily: ZNF423-like factors GCACCCAAGGGTGC  
  2.3.4.12.1 ZNF423 (OAZ, Zfp423) [1+7+5+7+10]   UniProt  ProteinAtlas T05178 UniProt UniProt  
  2.3.4.12.2 ZNF521 (EHZF, LIP3, Zfp521) [1+7+5+7+5+5]   UniProt  ProteinAtlas T20717 UniProt UniProt  
  2.3.4.13 Subfamily: ZNF639-like factors    
  2.3.4.13.1 ZNF639 (ZASC1, Zfp639) [4+4]   UniProt  ProteinAtlas T19539 UniProt UniProt  
  2.3.4.13.2 ZNF711 (CMPX1, ZNF6, Zfp711) [1+10]   UniProt  ProteinAtlas T21018 UniProt UniProt  
  2.3.4.14 Subfamily: Evi-1-like factors ACAAGATAA  
  2.3.4.14.1 EVI-1 (MECOM) [7+3]   UniProt  ProteinAtlas T05220 UniProt UniProt  
  2.3.4.14.2 PRDM16 (MEL1, PFM13) [7+3]   UniProt  ProteinAtlas T20075 UniProt UniProt  
  2.3.4.15 Subfamily: BCL11    
  2.3.4.15.1 BCL11A (CTIP1, EVI9, ZNF856) [1+2+3]   UniProt  ProteinAtlas T21924 UniProt UniProt  
  2.3.4.15.2 BCL11B (CTIP2, RIT1) [1+2+3]   UniProt  ProteinAtlas T22460 UniProt UniProt  
  2.3.4.15.3 ZNF296 (ZNF342, Zfp296) [1+2+3]   UniProt  ProteinAtlas T20504 UniProt UniProt  
  2.3.4.16 Subfamily: Insulinoma-associated proteins    
  2.3.4.16.1 INSM1 (IA-1) [2+1+2]   UniProt  ProteinAtlas T05887 UniProt   PDB
  2.3.4.16.2 INSM2 (IA-6) [2+3]   UniProt  ProteinAtlas T19996 UniProt UniProt  
  2.3.4.17 Subfamily: Hypermethylated in Cancer proteins GGGTGCCCGG  
  2.3.4.17.1 HIC1 (ZBTB29) [1+4] UniProt  ProteinAtlas T18968 UniProt UniProtF  
  2.3.4.17.2 HIC2 (HRG22, ZBTB30) [1+4] UniProt  ProteinAtlas T18971 UniProt UniProt  
  2.3.4.18 Subfamily: ZNF518    
  2.3.4.18.1 ZNF518A [4+1]   UniProt  ProteinAtlas T20200 UniProt UniProt  
  2.3.4.18.2 ZNF518B (Zfp518b) [2+1]   UniProt  ProteinAtlas T20203 UniProt UniProt  
  2.3.4.19 Subfamily: Basonuclin    
  2.3.4.19.1 BNC1 [2+2+2]   UniProt  ProteinAtlas T05191 UniProt UniProt  
  2.3.4.19.2 BNC2 [1+1+2]   UniProt  ProteinAtlas T23749 UniProt UniProt  
  2.3.4.20 Subfamily: TRERF1-like factors    
  2.3.4.20.1 TRERF1 (BCAR2, RAPA, TREP132) = 3.5.1.3.9 [1+1+1]   UniProt  ProteinAtlas T13997 UniProt UniProt  
  2.3.4.20.2 ZNF541 (Zfp541) [3+1+1] = 3.5.1.3.10   UniProt  ProteinAtlas T23756 UniProt UniProt  
  2.3.4.21 Subfamily: HINFP-like factors CGGACGTT  
  2.3.4.21.1 HINFP (MIZF, ZNF743) [1+8] UniProt  ProteinAtlas T01495 UniProt UniProt  
  2.3.4.21.2 ZFAT (ZFAT1, ZNF406) [1+1+7+10]   UniProt  ProteinAtlas T20266 UniProt UniProt PDB
  2.3.4.22 Subfamily: ZNF526-like factors    
  2.3.4.22.1 ZNF526 (Zfp526) [1+2+1+9]   UniProt  ProteinAtlas T20726 UniProt UniProt  
  2.3.4.22.2 ZNF574 (Zfp574) [3+1+4+8+4]   UniProt  ProteinAtlas T20816 UniProt UniProt  
  2.3.4.23 Subfamily: ZNF319-like factors    
  2.3.4.23.1 ZNF319 (Zfp319) [3+13]   UniProt  ProteinAtlas T20514 UniProt UniProt  
  2.3.4.23.2 ZNF786 (Zfp786) [2+14]   UniProt  ProteinAtlas T21086 UniProt UniProt  
  2.3.4.24 Subfamily: ZNF134-like factors    
  2.3.4.24.1 ZNF134 [2+9]   UniProt  ProteinAtlas T20371      
  2.3.4.24.2 ZNF671 [1+9]   UniProt  ProteinAtlas T20963      
  2.3.4.24.3 ZNF772 [2+8]   UniProt  ProteinAtlas T21053      
  2.3.4.24.4 ZNF792 [1+12]   UniProt  ProteinAtlas T21099      
  2.3.4.25 Subfamily: ZNF37A-like factors    
  2.3.4.25.1 ZNF37A (KOX21, ZNF37) [1+11]   UniProt  ProteinAtlas T20554      
  2.3.4.25.2 ZNF717 (KLF X17) [16+6]   UniProt  ProteinAtlas T21493      
  2.3.4.25.3 ZNF248 (Zfp248) [1+7]   UniProt  ProteinAtlas T20459 UniProt UniProt  
  2.3.4.25.4 ZNF334 (Zfp334) [9+5]   UniProt  ProteinAtlas T19466 UniProt UniProt  
  2.3.4.25.5 ZNF382 (KS1, Zfp382) [1+9]   UniProt  ProteinAtlas T20556 UniProt UniProt  
  2.3.4.25.6 ZNF510 [1+9]   UniProt  ProteinAtlas T20690      
  2.3.4.0 Subfamily: unclassified    
  2.3.4.0.1 CASZ1 (CST, SRG, ZNF693) [3+1+1+3]   UniProt  ProteinAtlas T19859 UniProt UniProt  
  2.3.4.0.2 ZNF335 (NIF-1, Zfp335) [1+8+4]   UniProt  ProteinAtlas T20528 UniProt UniProt  
  2.3.4.0.3 PRDM8 (PFM5) [1+2]   UniProt  ProteinAtlas T20086 UniProt UniProt  
  2.3.4.0.4 WIZ (ZNF803) [4+2+1+1+1+1+1]   UniProt  ProteinAtlas T23757 UniProt UniProt  
  2.3.4.0.5 ZNF469 [1+1+3]   UniProt  ProteinAtlas T20643 UniProtF UniProt  
  2.3.4.0.6 ZFPM1 (FOG1, ZFN89A) = 2.7.2.0.1 [3+1]   UniProt  ProteinAtlas T19938 UniProt UniProt  
  2.3.4.0.7 ZBTB4 (KAISO-L1) [1+3+2]   UniProt  ProteinAtlas T20256 UniProt UniProt PDB
  2.3.4.0.8 ZBTB38 [2+3+5]   UniProt  ProteinAtlas T20233 UniProt UniProt  
  2.3.4.0.9 ZBTB39 [2+3+3]   UniProt  ProteinAtlas T20235 UniProt UniProt  
  2.3.4.0.10 ZNF295 (ZBTB21) [2+1+2+2+1]   UniProt  ProteinAtlas T20502 UniProt   PDB
  2.3.4.0.11 ZNF827 [3+4+2]   UniProt  ProteinAtlas T21117 UniProt    
  2.3.4.0.12 PRDM13 (PFM10) [1+3]   UniProt  ProteinAtlas T20069 UniProt UniProt  
  2.3.4.0.13 ZNF646 (PFM10, Zfp646) [1+3]   UniProt  ProteinAtlas T19541 UniProt UniProtF  
  2.3.4.0.14 ZNF579 (Zfp579) [3+2+3]   UniProt  ProteinAtlas T20831 UniProt UniProt  
  2.3.4.0.15 RREB1 (FINB, Zep-1, LZ321) [3+2+1+5+1+1+2] CCCCAAACACCCCC UniProt  ProteinAtlas T01975 UniProt UniProt  
  2.3.4.0.16 PRDM2 (G3B, MTB-ZF, MTE-BP, KMT8, RIZ) [2+1+3+1+1] GTCATATGAC UniProt  ProteinAtlas T02286 UniProt UniProt  
  2.3.4.0.17 ZNF800 (Zfp800) [1+3+2+1]   UniProt  ProteinAtlas T21108 UniProt UniProt  
  2.3.4.0.18 ZNF618 (Zfp618) [3+1]   UniProt  ProteinAtlas T20881 UniProt UniProtF  
  2.3.4.0.19 ZNF277 (NRIF4, ZNF277P, Zfp277) [1+1]   UniProt  ProteinAtlas T19456 UniProt UniProt  
  2.3.4.0.20 TRPS1 (GC79) = 2.2.1.2.13 [1+1+3+2]   UniProt  ProteinAtlas T17430 UniProt UniProt  
  2.3.4.0.21 ZNF451 (COASTER, Zfp451) [1+3+2+3+2]   UniProt  ProteinAtlas T19500 UniProt UniProt  
  2.3.4.0.22 ZNF438 (Zfp438) [3+1]   UniProt  ProteinAtlas T20617 UniProt UniProt  
  2.3.4.0.23 PEG3 (ZSCAN24) [4+1+5+2]   UniProt  ProteinAtlas T22526 UniProt UniProt  
  2.3.4.0.24 ZNF507 (Zfp507) [2+1+3+2+1]   UniProt  ProteinAtlas T20685 UniProt UniProt  
  2.3.4.0.25 ZNF236 (Zfp236) [9+4+4+4+4+5]   UniProt  ProteinAtlas T20456 UniProt UniProt  
  2.3.4.0.26 ZNF770 (Zfp770) [3+3+1+2+2]   UniProt  ProteinAtlas T21045 UniProt UniProt  
  2.3.4.0.27 REST (NRSF, XBR) [1+7+1] TTCAGCACCACGGACAGCGCC UniProt  ProteinAtlas T06124 UniProt UniProt  
  2.3.4.0.28 ZFP57 (ZNF698) [4+3] TTCAGCACCACGGACAGCGCC UniProt  ProteinAtlas T20304 UniProt UniProt PDB
  2.3.4.0.29 ZNF8 (HF.18, Zfp128) [6+1]   UniProt  ProteinAtlas T19576 UniProt UniProt  
  2.3.4.0.30 ZNF597 (Zfp597) [4+3]   UniProt  ProteinAtlas T20855 UniProt UniProt  
  2.3.4.0.31 PRDM4 (PFM1) [1+5] UniProt  ProteinAtlas T18696 UniProt UniProt  
  2.3.4.0.32 PRDM15 (ZNF298) [1+15]   UniProt  ProteinAtlas T20073 UniProt UniProt  
  2.3.4.0.33 ZBTB41 (FRBZ1) [1+13]   UniProt  ProteinAtlas T20240 UniProt UniProt  
  2.3.4.0.34 PRDM10 (PFM7, TRIS) [1+9]   UniProt  ProteinAtlas T20060 UniProt UniProt  
  2.3.4.0.35 ZNF341 (Zfp341) [1+2+9]   UniProt  ProteinAtlas T20531 UniProt UniProtF  
  2.3.4.0.36 ZNF513 (Zfp513) [3+5]   UniProt  ProteinAtlas T20699 UniProt UniProt  
  2.3.4.0.37 ZNF142 (ZFP142) [14+17]   UniProt  ProteinAtlas T19417 UniProt UniProt  
  2.3.4.0.38 FIZ1 (ZNF798) [4+2+5]   UniProt  ProteinAtlas T23764 UniProt UniProt  
  2.3.4.0.39 ZNF628 (Zfp628) [7+2+6] CAAGGTTGGTTGC UniProt  ProteinAtlas T08325 UniProt UniProt  
  2.3.4.0.40 ZNF784 (Zfp784) [3+3] UniProt  ProteinAtlas T21079 UniProt UniProt  
  2.3.4.0.41 ZNF697 (Zfp697) [1+10]   UniProt  ProteinAtlas T21000 UniProt UniProt  
  2.3.4.0.42 ZKSCAN5 (ZFP95) [4+9]   UniProt  ProteinAtlas T04978 UniProt UniProt  
  2.3.4.0.43 ZNF316 (Zfp316) [6+9]   UniProt  ProteinAtlas T24088 UniProt UniProt  
  2.3.4.0.44 ZNF775 (Zfp775) [4+4+3]   UniProt  ProteinAtlas T21061 UniProt UniProt  
  2.3.4.0.45 ZNF467 (Zfp467) [7+5]   UniProt  ProteinAtlas T19509 UniProt UniProt  
  2.3.4.0.46 ZNF787 (TTF-I-IP20, Zfp787) [5+2]   UniProt  ProteinAtlas T19561 UniProt UniProt  
  2.3.4.0.48 ZNF48 (ZNF553, Zfp48, Zfp553) [8+2+2]   UniProt  ProteinAtlas T21190 UniProt UniProt  
  2.3.4.0.49 ZNF629 (ZNF65, Zfp629) [15+3+1]   UniProt  ProteinAtlas T20903 UniProt UniProt  
  2.3.4.0.50 ZNF668 (Zfp668) [13+3]   UniProt  ProteinAtlas T20957 UniProt UniProt  
  2.3.4.0.51 ZNF101 (HZF12) [1+9]   UniProt  ProteinAtlas T19413      
  2.3.4.0.52 ZNF251 [11+3]   UniProt  ProteinAtlas T20461      
  2.3.4.0.53 ZNF445 (ZKSCAN15, ZNF168) [12+2]   UniProt  ProteinAtlas T20625 UniProt UniProt  
  2.3.4.0.54 ZNF806 [7+1]   UniProt   T21354      
  2.3.4.0.56 ZSCAN20 (KOX29, ZNF31, ZNF360) [4+6]   UniProt  ProteinAtlas T19582 UniProt UniProt  
  2.3.4.0.57 ZNF674 [4+7]   UniProt  ProteinAtlas T21396      
  2.3.4.0.59 ZNF195 (ZNFP104) [2+8]   UniProt  ProteinAtlas T20410      
  2.3.4.0.60 ZNF788 (ZNF788P) [9+8]   UniProt  ProteinAtlas T21446      
  2.3.4.0.62 ZNF491 [1+12]   UniProt  ProteinAtlas T20662      
  2.3.4.0.63 ZNF778 [1+18]   UniProt  ProteinAtlas T21071      
  2.3.4.0.64 ZNF426 (Zfp426) [1+11]   UniProt  ProteinAtlas T19485 UniProt UniProt  
  2.3.4.0.65 ZFP112 (ZNF112, ZNF228) [1+16]   UniProt  ProteinAtlas T20262 UniProt UniProt  
  2.3.4.0.67 ZNF606 (ZNF328) [2+14]   UniProt  ProteinAtlas T20862 UniProt UniProt  
  2.3.4.0.68 ZNF519 [1+9]   UniProt  ProteinAtlas T20715      
  2.3.4.0.69 ZNF304 [2+14]   UniProt  ProteinAtlas T20510      
  2.3.4.0.70 ZNF132 [2+16]   UniProt  ProteinAtlas T20368      
  2.3.4.0.71 PRDM9 (PFM6) [1+13]   UniProt  ProteinAtlas T23770 UniProt UniProt  
  2.3.4.0.72 ZBTB17 (MIZ1, ZNF151, ZNF60) [12+1]   UniProt  ProteinAtlas T03414 UniProt UniProt  
  2.3.4.0.73 ZNF407 (Zfp407) [3+3+1+2+2+11]   UniProt  ProteinAtlas T20580 UniProt UniProt  
  2.3.4.0.74 E4F1 (p120E4F, p50E4F) [3+6] TACGTCAC UniProt  ProteinAtlas T00223 UniProt UniProt  
  2.3.4.0.75 ZNF462 (Zfp462) [1+2+2+1+3+1+1+3+2+1+4+5+1]   UniProt  ProteinAtlas T19507 UniProt UniProt PDB
  2.3.4.0.76 ZNF644 (ZEP2) [5+1+1]   UniProt  ProteinAtlas T20919 UniProt UniProt  
  2.3.4.0.77 ADNP (ADNP1) = 3.1.8.1.1 [4+3+2]   UniProt  ProteinAtlas T19734 UniProt UniProt  
  2.3.4.0.78 ADNP2 (ZNF508) = 3.1.8.1.2 [1+1+1+1]   UniProt  ProteinAtlas T19730 UniProt UniProt  
  2.3.5 Family: BED zinc finger factors TGTCGCGACA  
  2.3.5.0.1 ZBED1 (ALTE, DREF, TRAMP) UniProt  ProteinAtlas T27230     PDB
  2.3.5.0.2 ZBED2   UniProt  ProteinAtlas T27334      
  2.3.5.0.3 ZBED3   UniProt  ProteinAtlas T27335 UniProt UniProt  
  2.3.5.0.4 ZBED4   UniProt  ProteinAtlas T27336 UniProt UniProt  
  2.3.5.0.5 ZBED5   UniProt  ProteinAtlas T27337      
  2.3.5.0.6 ZBED6   UniProt  ProteinAtlas T27338 UniProt    
  2.4 Class: C6 zinc cluster factors TRANSFAC class description  
 
  2.5 Class: DM-type intertwined zinc finger factors Class description Further information  
  2.5.1 Family: DMRT TGATACATTGTTGC  
  2.5.1.0.1 DMRT1   UniProt  ProteinAtlas T10711 UniProt UniProt  
  2.5.1.0.2 DMRT2   UniProt  ProteinAtlas T10715 UniProt UniProt  
  2.5.1.0.3 DMRT3   UniProt  ProteinAtlas T10735 UniProt UniProt  
  2.5.1.0.4 DMRTA1 (DMRT4)   UniProt  ProteinAtlas T18888 UniProt UniProt  
  2.5.1.0.5 DMRTA2 (DMRT5)   UniProt  ProteinAtlas T22488 UniProt UniProt  
  2.5.1.0.6 DMRTB1   UniProt  ProteinAtlas T18890 UniProt UniProt  
  2.5.1.0.7 DMRTC2   UniProt  ProteinAtlas T18892 UniProt UniProt  
  2.5.1.0.8 DMRTC1 (no DM domain!)   UniProt  ProteinAtlas T23777 UniProt UniProt  
  2.6 Class: CXXC zinc finger factors Class description Further information  
  2.6.1 Family: CpG-binding proteins    
  2.6.1.0.1 CpG-binding protein (CXXC1, CFP1, CGBP, PCCX1, PHF18)   UniProt  ProteinAtlas T19899 UniProt UniProt  
  2.6.1.0.2 MBD1 (CXXC3, PCM1)   UniProt  ProteinAtlas T15268 UniProt UniProt  
  2.6.1.0.3 TET1 (CXXC6, LCX)   UniProt  ProteinAtlas T27319 UniProt UniProt  
  2.6.1.0.4 MLL (CXXC7, ALL1, HRX, HTRX, KMT2A, MLL1, TRX1)   UniProt  ProteinAtlas T02337 UniProt UniProt PDB
  2.6.1.0.5 KDM2A (CXXC8, FBL7, FBXL11, JHDM1A)   UniProt  ProteinAtlas T27165 UniProt UniProt  
  2.6.1.0.6 DNMT1 (CXXC9, AIM, DNMT)   UniProt  ProteinAtlas T06570 UniProt UniProt  
  2.6.1.0.7 MLL2 (HRX2, KMT2B, WBP7, MLL4, TRX2)   UniProt  ProteinAtlas T19080 UniProt UniProt  
  2.7 Class: C2HC zinc finger factors Class description Further information  
  2.7.1 Family: Myelin transcription factor-related proteins AAGTT  
  2.7.1.0.1 MYT1 (MyT1, MTF1, MYTI, PLPB1) [7]   UniProt  ProteinAtlas T04937 UniProt UniProt PDB
  2.7.1.0.2 MYT1L (MyT1L, NZF-1) [6]   UniProt  ProteinAtlas