| Classification of Human Transcription Factors - Families - | |||||||||||||||
| October 05, 2018 | |||||||||||||||
| Display detail: All levels | Superclasses | Classes | Families | Subfamilies | Genera | |||||||||||||||
| 1 | Superclass: Basic domains |  | |||||||||||||
| 1.1 | Class: Basic leucine zipper factors (bZIP) |  |  | ||||||||||||
| 1.1.1 | Family: Jun-related factors | TGAGTCA | |||||||||||||
| 1.1.2 | Family: Fos-related factors | (TGAGTCA) | |||||||||||||
| 1.1.3 | Family: Maf-related factors | TGCTGACTCAGCA | |||||||||||||
| 1.1.4 | Family: B-ATF-related factors | TGAGTCA | |||||||||||||
| 1.1.5 | Family: XBP-1-related factors | GGATGACGTGTACA | |||||||||||||
| 1.1.6 | Family: ATF-4-related factors | TGACGTCA | |||||||||||||
| 1.1.7 | Family: CREB-related factors | TGACGTCA | |||||||||||||
| 1.1.8 | Family: C/EBP-related | ATTGCGCAAT | |||||||||||||
| 1.1.0 | Family: ZIP only | ||||||||||||||
| 1.2 | Class: Basic helix-loop-helix factors (bHLH) |  |  | ||||||||||||
| 1.2.1 | Family: E2A-related factors | CAGGTG | |||||||||||||
| 1.2.2 | Family: MyoD / ASC-related factors | CAGGTG | |||||||||||||
| 1.2.3 | Family: Tal-related factors | CAGCTG | |||||||||||||
| 1.2.4 | Family: Hairy-related factors | CACGAG | |||||||||||||
| 1.2.5 | Family: PAS domain factors | CACGC | |||||||||||||
| 1.2.6 | Family: bHLH-ZIP factors | CACATG | |||||||||||||
| 1.2.8 | Family: HLH domain only | ||||||||||||||
| 1.3 | Class: Basic helix-span-helix factors (bHSH) |  |  | ||||||||||||
| 1.3.1 | Family: AP-2 | GCCTGAGGC | |||||||||||||
| 2 | Superclass: Zinc-coordinating DNA-binding domains |  | |||||||||||||
| 2.1 | Class: Nuclear receptors with C4 zinc fingers |  |  | ||||||||||||
| 2.1.1 | Family: Steroid hormone receptors (NR3) | ||||||||||||||
| 2.1.2 | Family: Thyroid hormone receptor-related factors (NR1) | ||||||||||||||
| 2.1.3 | Family: RXR-related receptors (NR2) | (TGACCT) | |||||||||||||
| 2.1.4 | Family: NGFI-B-related receptors (NR4) | TGACCTTT | |||||||||||||
| 2.1.5 | Family: FTZ-F1-related receptors (NR5) | TGACCTTG | |||||||||||||
| 2.1.6 | Family: GCNF-related receptors (NR6) | TGAACTTGACTTGA | |||||||||||||
| 2.1.7 | Family: DAX-related receptors (NR0) | TGACCTT | |||||||||||||
| 2.2 | Class: Other C4 zinc finger-type factors |  |  | ||||||||||||
| 2.2.1 | Family: GATA-type zinc fingers | ||||||||||||||
| 2.3 | Class: C2H2 zinc finger factors |  |  | ||||||||||||
| 2.3.1 | Family: Three-zinc finger Krüppel-related factors | ||||||||||||||
| 2.3.2 | Family: Other factors with up to three adjacent zinc fingers | ||||||||||||||
| 2.3.3 | Family: More than 3 adjacent zinc finger factors | ||||||||||||||
| 2.3.4 | Family: Factors with multiple dispersed zinc fingers | ||||||||||||||
| 2.3.5 | Family: BED zinc finger factors | TGTCGCGACA | |||||||||||||
| 2.4 | Class: C6 zinc cluster factors |  | |||||||||||||
| 2.5 | Class: DM-type intertwined zinc finger factors |  |  | ||||||||||||
| 2.5.1 | Family: DMRT | TGATACATTGTTGC | |||||||||||||
| 2.6 | Class: CXXC zinc finger factors |  |  | ||||||||||||
| 2.6.1 | Family: CpG-binding proteins | ||||||||||||||
| 2.7 | Class: C2HC zinc finger factors |  |  | ||||||||||||
| 2.7.1 | Family: Myelin transcription factor-related proteins | AAGTT | |||||||||||||
| 2.7.2 | Family: Friend of GATA proteins | ||||||||||||||
| 2.7.3 | Family: Histone acetyltransferases with C2HC zinc finger | ||||||||||||||
| 2.7.4 | Family: Lethal(3)malignant brain tumor-related proteins | ||||||||||||||
| 2.7.5 | Family: LYAR-related proteins | ||||||||||||||
| 2.8 | Class: C3H zinc finger factors |  |  | ||||||||||||
| 2.8.1 | Family: ZC3H8-related factors | ||||||||||||||
| 2.8.2 | Family: ZGPAT-related factors | ||||||||||||||
| 2.8.3 | Family: RC3H-related factors | ||||||||||||||
| 2.8.4 | Family: CNOT4-related factors | ||||||||||||||
| 2.9 | Class: C2CH THAP-type zinc finger factors |  |  | ||||||||||||
| 2.9.1 | Family: THAP-related factors | TTGCCCGTACT | |||||||||||||
| 3 | Superclass: Helix-turn-helix domains |  | |||||||||||||
| 3.1 | Class: Homeo domain factors |  |  | ||||||||||||
| 3.1.1 | Family: HOX-related factors | ||||||||||||||
| 3.1.2 | Family: NK-related factors | ||||||||||||||
| 3.1.3 | Family: Paired-related HD factors | ||||||||||||||
| 3.1.4 | Family: TALE-type homeo domain factors | ||||||||||||||
| 3.1.5 | Family: HD-LIM factors | AATTAA; | |||||||||||||
| 3.1.6 | Family: HD-SINE factors | GGTATCA | |||||||||||||
| 3.1.7 | Family: HD-PROS factors | ||||||||||||||
| 3.1.8 | Family: HD-ZF factors | ||||||||||||||
| 3.1.9 | Family: HD-CUT factors | ||||||||||||||
| 3.1.10 | Family: POU domain factors | ||||||||||||||
| 3.1.11 | Family: PHTF factors | ||||||||||||||
| 3.2 | Class: Paired box factors |  |  | ||||||||||||
| 3.2.1 | Family: Paired plus homeo domain | CTAATTAG | |||||||||||||
| 3.2.2 | Family: Paired domain only | ||||||||||||||
| 3.3 | Class: Fork head / winged helix factors |  |  | ||||||||||||
| 3.3.1 | Family: Forkhead box (FOX) factors | TGTTT | |||||||||||||
| 3.3.2 | Family: E2F-related factors | ||||||||||||||
| 3.3.3 | Family: RFX-related factors | ||||||||||||||
| 3.4 | Class: Heat shock factors |  |  | ||||||||||||
| 3.4.1 | Family: HSF factors | TTCCAGAAGCTTC | |||||||||||||
| 3.5 | Class: Tryptophan cluster factors |  |  | ||||||||||||
| 3.5.1 | Family: Myb/SANT domain factors | ||||||||||||||
| 3.5.2 | Family: Ets-related factors | GGAAG | |||||||||||||
| 3.5.3 | Family: Interferon-regulatory factors | AAGTGAA | |||||||||||||
| 3.6 | Class: TEA domain factors |  |  | ||||||||||||
| 3.6.1 | Family: TEF-1-related factors | CATTCC | |||||||||||||
| 3.7 | Class: ARID domain factors |    |  | ||||||||||||
| 3.7.1 | Family: ARID-related factors | ||||||||||||||
| 4 | Superclass: Other all-α-helical DNA-binding domains |  | |||||||||||||
| 4.1 | Class: High-mobility group (HMG) domain factors |  |  | ||||||||||||
| 4.1.1 | Family: SOX-related factors | ACAA | |||||||||||||
| 4.1.2 | Family: TOX-related factors | ||||||||||||||
| 4.1.3 | Family: TCF-7-related factors | TTCAAAG | |||||||||||||
| 4.1.4 | Family: PBRM1-related factors | ||||||||||||||
| 4.1.5 | Family: WHSC1-related factors | GGCATTGGAAA | |||||||||||||
| 4.1.6 | Family: UBF-related factors | ||||||||||||||
| 4.1.7 | Family: TFAM | ||||||||||||||
| 4.2 | Class: Heteromeric CCAAT-binding factors |  | |||||||||||||
| 4.2.1 | Family: Heteromeric CCAAT-binding factors | CCAAT | |||||||||||||
| 5 | Superclass: α-Helices exposed by β-structures |   | |||||||||||||
| 5.1 | Class: MADS box factors |  |  | ||||||||||||
| 5.1.1 | Family: Regulators of differentiation | CTAAAAATAG | |||||||||||||
| 5.1.2 | Family: Responders to external signals (SRF/RLM1) | CCATATATGG | |||||||||||||
| 5.2 | Class: E2-related factors | ||||||||||||||
| 5.2.1 | Family: E2 | ||||||||||||||
| 5.3 | Class: SAND domain factors |  |  | ||||||||||||
| 5.3.1 | Family: AIRE | ATTGGTTATATTGGTTA | |||||||||||||
| 5.3.2 | Family: DEAF | TTTCCG | |||||||||||||
| 5.3.3 | Family: GMEB | CTTCTGTATGAGCGCCAGTAT | |||||||||||||
| 5.3.4 | Family: Sp110 | ||||||||||||||
| 5.3.5 | Family: Sp140/Sp100 | ||||||||||||||
| 6 | Superclass: Immunoglobulin fold |  | |||||||||||||
| 6.1 | Class: Rel homology region (RHR) factors |  |  | ||||||||||||
| 6.1.1 | Family: NF-kappaB-related factors | ||||||||||||||
| 6.1.2 | Family: Ankyrin domain-only factors | ||||||||||||||
| 6.1.3 | Family: NFAT-related factors | ATGGAAA | |||||||||||||
| 6.1.4 | Family: CSL-related factors | CGTGGGAA | |||||||||||||
| 6.1.5 | Family: Early B-Cell Factor-related factors | TCCCTAGGGA | |||||||||||||
| 6.2 | Class: STAT domain factors |  |  | ||||||||||||
| 6.2.1 | Family: STAT factors | TTCCCGGAA | |||||||||||||
| 6.3 | Class: p53 domain factors |  |  | ||||||||||||
| 6.3.1 | Family: p53-related factors | GGACATGCCCGGGCATGTCC | |||||||||||||
| 6.4 | Class: Runt domain factors |  |  | ||||||||||||
| 6.4.1 | Family: Runt-related factors | TGTGGT | |||||||||||||
| 6.5 | Class: T-Box factors |  |  | ||||||||||||
| 6.5.1 | Family: Brachyury-related factors | TCACACCTAGGTGTGAAATT | |||||||||||||
| 6.5.2 | Family: TBrain-related factors | AGGTGTGAA | |||||||||||||
| 6.5.3 | Family: TBX1-related factors | ||||||||||||||
| 6.5.4 | Family: TBX2-related factors | AGGTGTGAG | |||||||||||||
| 6.5.5 | Family: TBX6-related factors | AATTTCACACCTAGGTGTGAAATT | |||||||||||||
| 6.6 | Class: NDT80 domain factors |  | |||||||||||||
| 6.6.1 | Family: Myelin gene regulatory factor-related factors | ||||||||||||||
| 6.7 | Class: Grainyhead domain factors |  | |||||||||||||
| 6.7.1 | Family: Grainyhead-related factors | ||||||||||||||
| 6.7.2 | Family: CP2-related factors | GCACAAACCAG | |||||||||||||
| 7 | Superclass: β-Hairpin exposed by an α/β-scaffold |  | |||||||||||||
| 7.1 | Class: SMAD/NF-1 DNA-binding domain factors |  |  | ||||||||||||
| 7.1.1 | Family: SMAD factors | GTCTAGAC | |||||||||||||
| 7.1.2 | Family: Nuclear factor 1 | TTGGCTATATGCCAA | |||||||||||||
| 7.2 | Class: GCM domain factors |  | |||||||||||||
| 7.2.1 | Family: GCM factors | ||||||||||||||
| 8 | Superclass: β-Sheet binding to DNA |  | |||||||||||||
| 8.1 | Class: TATA-binding proteins |  |  | ||||||||||||
| 8.1.1 | Family: TBP-related factors | TATAAA) | |||||||||||||
| 8.2 | Class: A.T hook factors |  |  | ||||||||||||
| 8.2.1 | Family: HMGA factors | GGAAATT | |||||||||||||
| 9 | Superclass: β-Barrel DNA-binding domains |  | |||||||||||||
| 9.1 | Class: Cold-shock domain factors |  |  | ||||||||||||
| 9.1.1 | Family: Dbp factors | CCAATCAG | |||||||||||||
| 0 | Superclass: Yet undefined DNA-binding domains |  | |||||||||||||
| 0.1 | Class: AXUD/CSRNP domain factors |  | |||||||||||||
| 0.1.1 | Family: CSRNP factors | AGAGTG | |||||||||||||
| 0.2 | Class: NonO domain factors |  | |||||||||||||
| 0.2.1 | Family: NonO-related factors | ||||||||||||||
| 0.3 | Class: Leucine-rich repeat flightless-interacting proteins |  | |||||||||||||
| 0.3.1 | Family: LRRFIP factors | AGCCCCCGGCG | |||||||||||||
| 0.4 | Class: NFX1-type putative zinc finger factors |  | |||||||||||||
| 0.4.1 | Family: NFX1 | CCTAGCAACAGATG | |||||||||||||
| 0.5 | Class: GTF2I domain factors |  | |||||||||||||
| 0.5.1 | Family: TFII-I-related | YCAYY | |||||||||||||
| 0.6 | Class: CG-1 domain factors |  | |||||||||||||
| 0.6.1 | Family: CAMTA factors | CGCG | |||||||||||||
| 0.0 | Class: Uncharacterized |  | |||||||||||||
| 0.0.1 | Family: Nuclear localized protein 1 | ||||||||||||||
| 0.0.2 | Family: PHF5 | ||||||||||||||
| 0.0.3 | Family: RFXANK | CAGTTGCCTAGCAACTA | |||||||||||||
| 0.0.4 | Family: RFXAP | CAGTTGCCTAGCAACTA | |||||||||||||
| 0.0.5 | Family: PUR | TGGCCAGGG | |||||||||||||
| 0.0.6 | Family: NRF | CGCATGCGCA | |||||||||||||
| 0.0.7 | Family: SPEN factors | ||||||||||||||