Classification of Human Transcription Factors - Families - |
|||||||||||||||
October 05, 2018 | |||||||||||||||
Display detail: All levels | Superclasses | Classes | Families | Subfamilies | Genera | |||||||||||||||
1 | Superclass: Basic domains | ||||||||||||||
1.1 | Class: Basic leucine zipper factors (bZIP) | ||||||||||||||
1.1.1 | Family: Jun-related factors | TGAGTCA | |||||||||||||
1.1.2 | Family: Fos-related factors | (TGAGTCA) | |||||||||||||
1.1.3 | Family: Maf-related factors | TGCTGACTCAGCA | |||||||||||||
1.1.4 | Family: B-ATF-related factors | TGAGTCA | |||||||||||||
1.1.5 | Family: XBP-1-related factors | GGATGACGTGTACA | |||||||||||||
1.1.6 | Family: ATF-4-related factors | TGACGTCA | |||||||||||||
1.1.7 | Family: CREB-related factors | TGACGTCA | |||||||||||||
1.1.8 | Family: C/EBP-related | ATTGCGCAAT | |||||||||||||
1.1.0 | Family: ZIP only | ||||||||||||||
1.2 | Class: Basic helix-loop-helix factors (bHLH) | ||||||||||||||
1.2.1 | Family: E2A-related factors | CAGGTG | |||||||||||||
1.2.2 | Family: MyoD / ASC-related factors | CAGGTG | |||||||||||||
1.2.3 | Family: Tal-related factors | CAGCTG | |||||||||||||
1.2.4 | Family: Hairy-related factors | CACGAG | |||||||||||||
1.2.5 | Family: PAS domain factors | CACGC | |||||||||||||
1.2.6 | Family: bHLH-ZIP factors | CACATG | |||||||||||||
1.2.8 | Family: HLH domain only | ||||||||||||||
1.3 | Class: Basic helix-span-helix factors (bHSH) | ||||||||||||||
1.3.1 | Family: AP-2 | GCCTGAGGC | |||||||||||||
2 | Superclass: Zinc-coordinating DNA-binding domains | ||||||||||||||
2.1 | Class: Nuclear receptors with C4 zinc fingers | ||||||||||||||
2.1.1 | Family: Steroid hormone receptors (NR3) | ||||||||||||||
2.1.2 | Family: Thyroid hormone receptor-related factors (NR1) | ||||||||||||||
2.1.3 | Family: RXR-related receptors (NR2) | (TGACCT) | |||||||||||||
2.1.4 | Family: NGFI-B-related receptors (NR4) | TGACCTTT | |||||||||||||
2.1.5 | Family: FTZ-F1-related receptors (NR5) | TGACCTTG | |||||||||||||
2.1.6 | Family: GCNF-related receptors (NR6) | TGAACTTGACTTGA | |||||||||||||
2.1.7 | Family: DAX-related receptors (NR0) | TGACCTT | |||||||||||||
2.2 | Class: Other C4 zinc finger-type factors | ||||||||||||||
2.2.1 | Family: GATA-type zinc fingers | ||||||||||||||
2.3 | Class: C2H2 zinc finger factors | ||||||||||||||
2.3.1 | Family: Three-zinc finger Krüppel-related factors | ||||||||||||||
2.3.2 | Family: Other factors with up to three adjacent zinc fingers | ||||||||||||||
2.3.3 | Family: More than 3 adjacent zinc finger factors | ||||||||||||||
2.3.4 | Family: Factors with multiple dispersed zinc fingers | ||||||||||||||
2.3.5 | Family: BED zinc finger factors | TGTCGCGACA | |||||||||||||
2.4 | Class: C6 zinc cluster factors | ||||||||||||||
2.5 | Class: DM-type intertwined zinc finger factors | ||||||||||||||
2.5.1 | Family: DMRT | TGATACATTGTTGC | |||||||||||||
2.6 | Class: CXXC zinc finger factors | ||||||||||||||
2.6.1 | Family: CpG-binding proteins | ||||||||||||||
2.7 | Class: C2HC zinc finger factors | ||||||||||||||
2.7.1 | Family: Myelin transcription factor-related proteins | AAGTT | |||||||||||||
2.7.2 | Family: Friend of GATA proteins | ||||||||||||||
2.7.3 | Family: Histone acetyltransferases with C2HC zinc finger | ||||||||||||||
2.7.4 | Family: Lethal(3)malignant brain tumor-related proteins | ||||||||||||||
2.7.5 | Family: LYAR-related proteins | ||||||||||||||
2.8 | Class: C3H zinc finger factors | ||||||||||||||
2.8.1 | Family: ZC3H8-related factors | ||||||||||||||
2.8.2 | Family: ZGPAT-related factors | ||||||||||||||
2.8.3 | Family: RC3H-related factors | ||||||||||||||
2.8.4 | Family: CNOT4-related factors | ||||||||||||||
2.9 | Class: C2CH THAP-type zinc finger factors | ||||||||||||||
2.9.1 | Family: THAP-related factors | TTGCCCGTACT | |||||||||||||
3 | Superclass: Helix-turn-helix domains | ||||||||||||||
3.1 | Class: Homeo domain factors | ||||||||||||||
3.1.1 | Family: HOX-related factors | ||||||||||||||
3.1.2 | Family: NK-related factors | ||||||||||||||
3.1.3 | Family: Paired-related HD factors | ||||||||||||||
3.1.4 | Family: TALE-type homeo domain factors | ||||||||||||||
3.1.5 | Family: HD-LIM factors | AATTAA; | |||||||||||||
3.1.6 | Family: HD-SINE factors | GGTATCA | |||||||||||||
3.1.7 | Family: HD-PROS factors | ||||||||||||||
3.1.8 | Family: HD-ZF factors | ||||||||||||||
3.1.9 | Family: HD-CUT factors | ||||||||||||||
3.1.10 | Family: POU domain factors | ||||||||||||||
3.1.11 | Family: PHTF factors | ||||||||||||||
3.2 | Class: Paired box factors | ||||||||||||||
3.2.1 | Family: Paired plus homeo domain | CTAATTAG | |||||||||||||
3.2.2 | Family: Paired domain only | ||||||||||||||
3.3 | Class: Fork head / winged helix factors | ||||||||||||||
3.3.1 | Family: Forkhead box (FOX) factors | TGTTT | |||||||||||||
3.3.2 | Family: E2F-related factors | ||||||||||||||
3.3.3 | Family: RFX-related factors | ||||||||||||||
3.4 | Class: Heat shock factors | ||||||||||||||
3.4.1 | Family: HSF factors | TTCCAGAAGCTTC | |||||||||||||
3.5 | Class: Tryptophan cluster factors | ||||||||||||||
3.5.1 | Family: Myb/SANT domain factors | ||||||||||||||
3.5.2 | Family: Ets-related factors | GGAAG | |||||||||||||
3.5.3 | Family: Interferon-regulatory factors | AAGTGAA | |||||||||||||
3.6 | Class: TEA domain factors | ||||||||||||||
3.6.1 | Family: TEF-1-related factors | CATTCC | |||||||||||||
3.7 | Class: ARID domain factors | ||||||||||||||
3.7.1 | Family: ARID-related factors | ||||||||||||||
4 | Superclass: Other all-α-helical DNA-binding domains | ||||||||||||||
4.1 | Class: High-mobility group (HMG) domain factors | ||||||||||||||
4.1.1 | Family: SOX-related factors | ACAA | |||||||||||||
4.1.2 | Family: TOX-related factors | ||||||||||||||
4.1.3 | Family: TCF-7-related factors | TTCAAAG | |||||||||||||
4.1.4 | Family: PBRM1-related factors | ||||||||||||||
4.1.5 | Family: WHSC1-related factors | GGCATTGGAAA | |||||||||||||
4.1.6 | Family: UBF-related factors | ||||||||||||||
4.1.7 | Family: TFAM | ||||||||||||||
4.2 | Class: Heteromeric CCAAT-binding factors | ||||||||||||||
4.2.1 | Family: Heteromeric CCAAT-binding factors | CCAAT | |||||||||||||
5 | Superclass: α-Helices exposed by β-structures | ||||||||||||||
5.1 | Class: MADS box factors | ||||||||||||||
5.1.1 | Family: Regulators of differentiation | CTAAAAATAG | |||||||||||||
5.1.2 | Family: Responders to external signals (SRF/RLM1) | CCATATATGG | |||||||||||||
5.2 | Class: E2-related factors | ||||||||||||||
5.2.1 | Family: E2 | ||||||||||||||
5.3 | Class: SAND domain factors | ||||||||||||||
5.3.1 | Family: AIRE | ATTGGTTATATTGGTTA | |||||||||||||
5.3.2 | Family: DEAF | TTTCCG | |||||||||||||
5.3.3 | Family: GMEB | CTTCTGTATGAGCGCCAGTAT | |||||||||||||
5.3.4 | Family: Sp110 | ||||||||||||||
5.3.5 | Family: Sp140/Sp100 | ||||||||||||||
6 | Superclass: Immunoglobulin fold | ||||||||||||||
6.1 | Class: Rel homology region (RHR) factors | ||||||||||||||
6.1.1 | Family: NF-kappaB-related factors | ||||||||||||||
6.1.2 | Family: Ankyrin domain-only factors | ||||||||||||||
6.1.3 | Family: NFAT-related factors | ATGGAAA | |||||||||||||
6.1.4 | Family: CSL-related factors | CGTGGGAA | |||||||||||||
6.1.5 | Family: Early B-Cell Factor-related factors | TCCCTAGGGA | |||||||||||||
6.2 | Class: STAT domain factors | ||||||||||||||
6.2.1 | Family: STAT factors | TTCCCGGAA | |||||||||||||
6.3 | Class: p53 domain factors | ||||||||||||||
6.3.1 | Family: p53-related factors | GGACATGCCCGGGCATGTCC | |||||||||||||
6.4 | Class: Runt domain factors | ||||||||||||||
6.4.1 | Family: Runt-related factors | TGTGGT | |||||||||||||
6.5 | Class: T-Box factors | ||||||||||||||
6.5.1 | Family: Brachyury-related factors | TCACACCTAGGTGTGAAATT | |||||||||||||
6.5.2 | Family: TBrain-related factors | AGGTGTGAA | |||||||||||||
6.5.3 | Family: TBX1-related factors | ||||||||||||||
6.5.4 | Family: TBX2-related factors | AGGTGTGAG | |||||||||||||
6.5.5 | Family: TBX6-related factors | AATTTCACACCTAGGTGTGAAATT | |||||||||||||
6.6 | Class: NDT80 domain factors | ||||||||||||||
6.6.1 | Family: Myelin gene regulatory factor-related factors | ||||||||||||||
6.7 | Class: Grainyhead domain factors | ||||||||||||||
6.7.1 | Family: Grainyhead-related factors | ||||||||||||||
6.7.2 | Family: CP2-related factors | GCACAAACCAG | |||||||||||||
7 | Superclass: β-Hairpin exposed by an α/β-scaffold | ||||||||||||||
7.1 | Class: SMAD/NF-1 DNA-binding domain factors | ||||||||||||||
7.1.1 | Family: SMAD factors | GTCTAGAC | |||||||||||||
7.1.2 | Family: Nuclear factor 1 | TTGGCTATATGCCAA | |||||||||||||
7.2 | Class: GCM domain factors | ||||||||||||||
7.2.1 | Family: GCM factors | ||||||||||||||
8 | Superclass: β-Sheet binding to DNA | ||||||||||||||
8.1 | Class: TATA-binding proteins | ||||||||||||||
8.1.1 | Family: TBP-related factors | TATAAA) | |||||||||||||
8.2 | Class: A.T hook factors | ||||||||||||||
8.2.1 | Family: HMGA factors | GGAAATT | |||||||||||||
9 | Superclass: β-Barrel DNA-binding domains | ||||||||||||||
9.1 | Class: Cold-shock domain factors | ||||||||||||||
9.1.1 | Family: Dbp factors | CCAATCAG | |||||||||||||
0 | Superclass: Yet undefined DNA-binding domains | ||||||||||||||
0.1 | Class: AXUD/CSRNP domain factors | ||||||||||||||
0.1.1 | Family: CSRNP factors | AGAGTG | |||||||||||||
0.2 | Class: NonO domain factors | ||||||||||||||
0.2.1 | Family: NonO-related factors | ||||||||||||||
0.3 | Class: Leucine-rich repeat flightless-interacting proteins | ||||||||||||||
0.3.1 | Family: LRRFIP factors | AGCCCCCGGCG | |||||||||||||
0.4 | Class: NFX1-type putative zinc finger factors | ||||||||||||||
0.4.1 | Family: NFX1 | CCTAGCAACAGATG | |||||||||||||
0.5 | Class: GTF2I domain factors | ||||||||||||||
0.5.1 | Family: TFII-I-related | YCAYY | |||||||||||||
0.6 | Class: CG-1 domain factors | ||||||||||||||
0.6.1 | Family: CAMTA factors | CGCG | |||||||||||||
0.0 | Class: Uncharacterized | ||||||||||||||
0.0.1 | Family: Nuclear localized protein 1 | ||||||||||||||
0.0.2 | Family: PHF5 | ||||||||||||||
0.0.3 | Family: RFXANK | CAGTTGCCTAGCAACTA | |||||||||||||
0.0.4 | Family: RFXAP | CAGTTGCCTAGCAACTA | |||||||||||||
0.0.5 | Family: PUR | TGGCCAGGG | |||||||||||||
0.0.6 | Family: NRF | CGCATGCGCA | |||||||||||||
0.0.7 | Family: SPEN factors | ||||||||||||||