Supported formats

Which data types we can work with

We can process your genomics, transcriptomics, epigenomics, proteomics, and metabolomics data coming in the following formats:

Transcriptomics (RNA-seq, microarrays)

*.txt, *.csv, *.xls (table with gene identifiers)

*.CEL (affymetrix)

*.txt (special agilent format)

*.txt (special illumina format)

*.fastq

Epigenomics (ChIP-seq)

*.fastq

*.bam

*.bed

*.txt (table with illumina methylation probe ids, cg*)

Genomics

*.vcf

*.txt, *.csv, *.xls (table data with SNP identifiers, rs*), *.tsv

*.fastq

Proteomics

*.txt, *.csv, *.xls (table with protein identifiers)

Metabolomics

*.txt, *.csv, *.xls (table with the list of metabolites from chebi database, e.g. CHEBI:57316)

miRNA

*.txt, *.csv, *.xls (table with the list of miRNA IDs from miRBase database, e.g. hsa-let-7a-5p, or miRNA accession numbers, e.g. MIMAT0000062, or mature sequence, e.g. UGAGGUAGUAGGUUGUAUAGUU)

Additional datatypes can be discussed and agreed upon in individual requests.

Contact us via this form to describe your task and receive an estimate for your project.

Supported species

Our renowned gene regulation competence can be applied for any eucaryotic species: you can provide any genomic sequence to us and we will identify transcription factors that can act on it.

If the organisms of your interest are human, mouse or rat, a much wider number of services will be available to you, including pathway analysis and disease molecular mechanism studies.

We also have an extended number of services for the following species: Arabidopsis thaliana (Arabidopsis), Drosophila melanogaster (fruit fly), Caenorhabditis elegans (nematoda), Danio rerio (zebrafish), Saccharomyces cerevisiae (baker’s yeast), and Schizosaccharomyces pombe (fission yeast).